This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Understanding the textual output file of FastQC - Per Base N Content

Hi,

I know that the fastqc_report.html generated by FastQC shows the Module of Per Base N Content with percents, but the textual output file generated as fastqc_data.txt shows the data of the same module as follows:

Per base N content  pass
#Base   N-Count
1   0.005880142888664921
2   7.156360513588139E-5
3   1.19272675226469E-5
4   0.0039121437474281835
5   0.009816141171138397
6   0.011378613216605141
7   0.02527387988048878
8   0.025476643428373778
9   0.024379334816290264
10  0.03693874751763745

Does the N-Count column in the textual data file represent percents or does it represent counts of N in that base's reads?

fastqc fastqc

Well, as counts should be integer and that fastqc outputed float numbers I would say it's a percentage

It does not make sense to have 0.1 N counts on a given base.

1 answer

Hi,

It is the percentage of N ambiguous bases found a each bp position.

You can test it by creating some fake fastq data:

@fake_1
ATGCAGTCGATGTGCTANNN
+
ATGCAGTCGATGTGCTA!!!
@fake_2
ATGCAGTCGATGTGCTNNNN
+
ATGCAGTCGATGTGCT!!!!
@fake_3
ATGCAGTCGATGTGCTATGT
+
ATGCAGTCGATGTGCTATGC
@fake_4
NNGCAGTCGATGTGCTATGC
+
!!GCAGTCGATGTGCTATGT

The result is this:

>>Per base N content    fail
#Base   N-Count
1   25.0
2   25.0
3   0.0
4   0.0
5   0.0
6   0.0
7   0.0
8   0.0
9   0.0
10  0.0
11  0.0
12  0.0
13  0.0
14  0.0
15  0.0
16  0.0
17  25.0
18  50.0
19  50.0
20  50.0

António

Log in to answer this question.