Hi everybody! I'm new to bioinformatics and to this forum. I have Illumina paired-end whole genome sequencing data (read length is 150bp) aligned with bwa. There are regions where all reads are mapped with zero quality. I took all reads covering a specific coordinate from such region:

$ samtools view algn_srt.bam "chr21:43063074-43063074" | cut -f 1 | sort | uniq -c

This results in 28 reads:

  1 V300033420L1C001R0181033041
  1 V300033420L1C001R0300317239
  1 V300033420L1C001R0470415198
  1 V300033420L1C003R0011383109
  1 V300033420L1C003R0081312154
  2 V300033420L1C003R0130543193
  1 V300033420L1C003R0140107287
  1 V300033420L1C003R0170739418
  1 V300033420L1C003R0230130936
  1 V300033420L1C003R0231300468
  1 V300033420L1C003R0300977382
  3 V300033420L1C003R0371074884
  2 V300033420L1C003R0371074885
  1 V300033420L1C003R0510100518
  1 V300033420L1C003R0671044234
  1 V300033420L1C004R0210447304
  1 V300033420L1C004R0371389897
  1 V300033420L1C004R0380756132
  1 V300033420L1C004R0550261504
  1 V300033420L1C005R0090362628
  2 V300033420L1C005R0090658320
  1 V300033420L1C005R0160918804
  1 V300033420L1C005R0330628576
  1 V300033420L1C005R0391023819
  1 V300033420L1C006R0021214012
  1 V300033420L1C006R0060892638
  1 V300033420L1C006R0060892639
  1 V300033420L1C006R0161090838

Most reads cross the specified coordinate exactly once, but three reads cross it 2 times (I guess that's an indication of a possible deletion, because paired reads are displayed with their common base name), and there is one read which crosses the coordinate 3 times (how is this possible btw?).

Most reads aligned with CIGAR string 150M:

$ samtools view algn_srt.bam "chr21:43063074-43063074" | cut -f 6 | grep 150M | wc -l
20

Next I searched for other places where the reads are mapped:

$ samtools view algn_srt.bam | grep -f read_names.txt >> mq_0.sam
$ samtools view mq_0.sam | cut -f 1 | sort | uniq -c
  2 V300033420L1C001R0181033041
  2 V300033420L1C001R0300317239
  3 V300033420L1C001R0470415198
  2 V300033420L1C003R0011383109
  2 V300033420L1C003R0081312154
  2 V300033420L1C003R0130543193
  2 V300033420L1C003R0140107287
  2 V300033420L1C003R0170739418
  2 V300033420L1C003R0230130936
  2 V300033420L1C003R0231300468
  2 V300033420L1C003R0300977382
  3 V300033420L1C003R0371074884
  3 V300033420L1C003R0371074885
  2 V300033420L1C003R0510100518
  2 V300033420L1C003R0671044234
  2 V300033420L1C004R0210447304
  2 V300033420L1C004R0371389897
  2 V300033420L1C004R0380756132
  2 V300033420L1C004R0550261504
  2 V300033420L1C005R0090362628
  3 V300033420L1C005R0090658320
  2 V300033420L1C005R0160918804
  2 V300033420L1C005R0330628576
  2 V300033420L1C005R0391023819
  2 V300033420L1C006R0021214012
  2 V300033420L1C006R0060892638
  2 V300033420L1C006R0060892639
  2 V300033420L1C006R0161090838

Most reads are encountered two times, that's because their mates are displayed with the same name. Only two reads map to a distant place:

V300033420L1C003R0371074885 339 chr21   6454741 0   82H68M  =   43062949    36608142    GATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGGCCAGCAAAAGCCCCGCCTGGAC    GFFFGFFCDFGGEFFFFFFGEFGGGF>FFGFFFFFEGFGG>FGFFFFFFFFFFFFFFDFFCGFCFFGF    SA:Z:chr21,43063049,-,81M69S,0,2;   XA:Z:chr21,-43063063,82S68M,1;  MC:Z:150M   MD:Z:11A56  NM:i:1  AS:i:63 XS:i:63
V300033420L1C001R0470415198 81  chr21   6454910 0   150M    =   43063063    36608005    GGATGAGAAACCCAAGAACCCAGGCCCCAAGTATTAAAGCGGTAATGACCTAAATGTTCAGTGCAGGGCGCTCAGAAGTAAAGGCAGGTGCCTGGGAGGAACTGACCTCCCCGGGGTGCTTCTCGGAGCGGGGCCCCCAGGACAGTCCAG  E=FEFFGFDCFDGFDGF.GFGFG0F'FGGFGEFFFGFBAFEG6FEFFCFFFF?GFFF3GFFFGEFGFFGDEDFGFGGGGGFGGGGFFFGFGFFAFFFFFGGGGGFFFFFFFGGGFFGGF;FGFFGFFGFFGFFFFFFEFF

So the question is: why mapping quality of all these reads is zero, when only two of them have another location where they are mapped?

Thanks!