This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Does anyone have experience of methylation alignment tool "Bismark"?

Hi, I'm trying to align my methylation data using Bismark

I did something.... so I got .bam file. I converted it to .sam to see how it looks like.

I saw weird thing(sequence?) like

K00171:752:HW5LHBBXX:4:1207:3082:33457_1:N:0:CGACACAC 83 chr1 10003 6 101M = 10009 -107 ACCCTAGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC TAACCCTAACCCTAACCCTAACCCTAACCCT **-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa nm:i:1="" md:z:6a94="" xm:z:.........................="" ............................................................................="" xr:z:ct="" xg:z:ga<="" p="">

What does this mean?

-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa< strong="">

bismark methylation ngs
• 1,615 views • link
updated by MatthewP MatthewP • written by kwanghoon • kwanghoon

1 answer

Hey, go see Bismark Docs you will see this field is QUAL which means sequencing quality, so this should the same with quality value in fastq file.

• 0 views • link
written by MatthewP MatthewP

yeah I saw that docs too. I was not sure about that so I made question. Anyway thank you!

• 0 views • link
written by kwanghoon • kwanghoon

If an answer was helpful, please indicate that by upvoting.

You can also find more information about sequencing quality scores in the description of FASTQ files

• 0 views • link
written by Friederike Friederike

Log in to answer this question.

More posts like this

No similar posts found.