This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Does anyone have experience of methylation alignment tool "Bismark"?

Hi, I'm trying to align my methylation data using Bismark

I did something.... so I got .bam file. I converted it to .sam to see how it looks like.

I saw weird thing(sequence?) like

K00171:752:HW5LHBBXX:4:1207:3082:33457_1:N:0:CGACACAC 83 chr1 10003 6 101M = 10009 -107 ACCCTAGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC TAACCCTAACCCTAACCCTAACCCTAACCCT **-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa nm:i:1="" md:z:6a94="" xm:z:.........................="" ............................................................................="" xr:z:ct="" xg:z:ga<="" p="">

What does this mean?

-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa< strong="">

bismark methylation ngs

1 answer

Hey, go see Bismark Docs you will see this field is QUAL which means sequencing quality, so this should the same with quality value in fastq file.

yeah I saw that docs too. I was not sure about that so I made question. Anyway thank you!

If an answer was helpful, please indicate that by upvoting.

You can also find more information about sequencing quality scores in the description of FASTQ files

Log in to answer this question.