This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Automatically change N for consensus sequence

I have thousands of fasta sequences, and many of them have N letters in the middle os alignment. I would like to use this sequences to test a tool, but i don't want just retire de N letters, but change it for consensus of my whole alignment. Any way to do it easily?

fasta
• 1,166 views • link
written by dasilvauirajan • dasilvauirajan

can you please rephrase the question or give an example?

• 0 views • link
written by cpad0112 cpad0112 
Consense:                 TGATGTCTATTAATTACGTA
My fasta sequences:       TGATGTCTNNNNNTACGTA
                          TGNNNTCTATTAATTACGTA
                          TGATGTCTATTAATTACGTA

I want to replace the N letters with correspondent consense letter

• 0 views • link
updated by GenoMax GenoMax • written by dasilvauirajan • dasilvauirajan

Please define an invariable sequence with in the pattern. If every position is replaceable, it is not easy to replace the Ns.

• 0 views • link
written by cpad0112 cpad0112

0 answers

No answers yet.

Log in to answer this question.

More posts like this