This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Automatically change N for consensus sequence

I have thousands of fasta sequences, and many of them have N letters in the middle os alignment. I would like to use this sequences to test a tool, but i don't want just retire de N letters, but change it for consensus of my whole alignment. Any way to do it easily?

fasta
• 1,174 views • link
written by dasilvauirajan 2

It is nucleotide sequences by the way

• 0 views • link
written by dasilvauirajan 2

can you please rephrase the question or give an example?

• 0 views • link
written by cpad0112 2.1K 
Consense:                 TGATGTCTATTAATTACGTA
My fasta sequences:       TGATGTCTNNNNNTACGTA
                          TGNNNTCTATTAATTACGTA
                          TGATGTCTATTAATTACGTA

I want to replace the N letters with correspondent consense letter

• 0 views • link
updated by GenoMax 16K • | written by dasilvauirajan 2

Please define an invariable sequence with in the pattern. If every position is replaceable, it is not easy to replace the Ns.

• 0 views • link
written by cpad0112 2.1K

0 answers

No answers yet.

Log in to answer this question.

More posts like this