This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Blasr PacBio aligner: Unexpected sam file output

I am aligning some PacBio single read sequences using Blasr. I was able to successfully align and create a Sam file for some of my sequences, but some report a sam file that begins like the following:

@HD     VN:1.5  SO:UNKNOWN      pb:3.0.1
@SQ     SN:gi/0/0_1667892       LN:1667892      M5:f8a1580a28e068939d886d1c70879a72
@RG     ID:95680781     PL:PACBIO       DS:READTYPE=SUBREAD;DeletionQV=dq;DeletionTag=dt;InsertionQV=iq;MergeQV=mq;SubstitutionQV=sq    PU:/home/akm126/HpGP_Data/HON001_edit.fasta    PM:SEQUEL
@PG     ID:1    PN:BLASR        VN:5.3.3        CL:blasr /home/akm126/HpGP_Data/HON001_edit.fasta /home/akm126/HpGP_Data/HP_bacteria/HP_bacteria.fasta --sam --out alignment1_test.sam
Rabkin_HON001/0/0_166079401     16      gi/0/0_1667892  1751    254     47825S25=1D1=2D1=1D2=3D1=1D1=1D45=2D1=5D1=1D8=1X1=1X39=2D1=3D1=2D46=1X4=6D10=1X44=1D2=2
D1=1D2=1D4=1X29=1X2=1X2=1D1=1I2=1X2=2D2=1D1=1D41=1X1=1X11=3D39=1X11=1X6=2D2=1X55=1D18=1X6=1X43=1I1=1D9=1X1=1X13=1X21=1X24=1X18=2X13=1D21=1X1=1X24= 1X8=1X2D55=2D1=1D54=1I2=3D1=2D5=1X1D5=1X2=1X4=1D1=2I26=1X1=1X1=2D1=1D1=2D49=1X1D2

I can't find any differences in the header between files. Any ideas why the "1D1=1D2" is happening? Thanks.

alignment

A small educational note: I added (code) markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

1 answer

I can't find any differences in the header between files

What do you mean? If you are aligning to the same set of references the headers are likely going stay (@HD and @SQ lines) identical.

Any ideas why the "1D1=1D2" is happening?

That should be the CIGAR string. 47825S25= a large number of bases at beginning of read match perfectly.

Hi, thanks for your help. To clarify, here is what the other sam files look like.

@HD     VN:1.5  SO:UNKNOWN      pb:3.0.1
@SQ     SN:unitig_5/0/0_14675   LN:14675        M5:7173f2f30d5793c2c0206670cf23f34f
@SQ     SN:unitig_0|quiver|quiver/0/0_1727168ATGGTGCGAACAAATCTCTACAAAGTTTTGATTTTCACTCAAAAACCCATACCCAGGGAAAATCGCATCGGCTTCAAACAATTCCGCCGCGCTGATGATCGCAGGGATATTCAAGTAACTCTCGCTGGATT
TGGCCCCCCCTATACACACTTTTGCGTTAGCCGTATTGAGGTAGTGGGCGTCCTT

This sam file converts into a VCF no problem, but the above sam file does not. By difference in header, I am referring to the Blasr guidelines here (https://github.com/PacificBiosciences/blasr/wiki/BLASR-Frequently-Asked-Questions )

If I was to hazard a guess it looks like the fasta header for unitig_0|quiver|quiver/0/0_1727168 appears to have sequence in the header itself. Can you check the original fasta file for that sequence? You will need to fix that and re-run the alignment.

I reformatted your example above using code button as shown by @lieven above. Edit as necessary if not correct.

Ah that is right, I see it now. Thank you for your help!

Log in to answer this question.