I have a gff like this:
Bany_Scaf24 maker gene 41357 46444 . + . ID=Bany_09696;Name=Bany_09696;Alias=maker-Bany_Scaf24-exonerate_est2genome-gene-0.0;
Bany_Scaf24 maker mRNA 41357 46444 . + . ID=Bany_09696-RA;Parent=Bany_09696;Name=Bany_09696-RA;Alias=maker-Bany_Scaf24-exonerate_est2genome-gene-0.0-mRNA-1;_AED=0.00;_QI=277|1|1|1|0|0|2|35|76;_eAED=0.00;score=1829;
Bany_Scaf24 maker exon 46189 46444 . + . ID=Bany_09696-RA:1;Parent=Bany_09696-RA;
Bany_Scaf24 maker exon 41357 41643 . + . ID=Bany_09696-RA:2;Parent=Bany_09696-RA;
Bany_Scaf24 maker five_prime_UTR 41357 41633 . + . ID=Bany_09696-RA:five_prime_utr;Parent=Bany_09696-RA;
Bany_Scaf24 maker CDS 41634 41643 . + 0 ID=Bany_09696-RA:cds;Parent=Bany_09696-RA;
Bany_Scaf24 maker CDS 46189 46409 . + 2 ID=Bany_09696-RA:cds;Parent=Bany_09696-RA;
Bany_Scaf24 maker three_prime_UTR 46410 46444 . + . ID=Bany_09696-RA:three_prime_utr;Parent=Bany_09696-RA;
B
I know I could generate fasta files for each transcript using gffread.
Here is how the result looks like:
>Bany_18948-RA CDS=213-977
TGTAGGTACCTCGATAAAAATACAATATTTAAAATGACAATACAAAAAATTGTCTATTTATAGTAGGTAT
AGATAGGTAGGTACGTTGAAAATCCAAAGTAAAATTGTACTTAGTACTACGTATTGATAATGAAACAATA
GATTATCATTTGATTAGGTAAATTACAAT
I assume each sequence represents the mature transcript (5'UTR, ORF(CDS),3'UTR), where 1-n represent the whole mature transcript, 1-212 represents the 5'UTR (excluding introns), 213-977 represents ORF (CDS) (excluding introns), and 978-n represents 3'UTR (excluding introns).
Am I right? I am not sure if introns within UTRs are indeed included in this sequence...I do have UTRs fragmented by introns.
If that is the case, how can I extract sequences of those lower level features by transcripts? For example, I hope to get a fasta file like this:
>Bany_18948-RA
TGTAGGTACCTCGATAAAAATACAATATTTAAAATGACAATACAAAAAATTGTCTATTTATAGTAGGTAT AGATAGGTAGGTACGTTGAAAATCCAAAGTAAAATTGTACTTAGTACTACGTATTGATAATGAAACAATA GATTATCATTTGATTAGGTAAATTACAAT
where the sequence only represents the 3'UTR region (or ORF region, 5'UTR) of mature transcript Bany_18948-RA, excluding introns.
If it cannot be done using gffread, is there any other tools for this? Thank you.
0 answers
No answers yet.
Log in to answer this question.
I don’t know for gffread but same answer as before you can do it with
agat_sp_extract_sequences.plfrom AGATFor cds:
agat_sp_extract_sequences.pl --gff input.gff --fasta input.fasta -o cds.fafor five_prime_UTR features:
agat_sp_extract_sequences.pl --gff input.gff --fasta input.fasta -t five_prime_UTR -o result_five_prime.fafor three_prime_UTR features:
agat_sp_extract_sequences.pl --gff input.gff --fasta input.fasta -t three_prime_UTR -o result_three_prime.faThank you for your answer Juke34, will give it a try