Bowtie2 adds insertions instead of allowing extention
Say, I'm aligning, with Bowtie2 default settings, this short read:
>read
AGTGATCAGTGGTACACCATGTACGAATTCTCGCCTGCGAGACGA
to this short reference:
>oligo40
AGTGATCAGTGGTACACCATGTACGAATTCTCGCCTGCGA
The read is a bit longer than the reference. The problem: Bowtie aligns it resulting in this CIGAR string: 36M5I4M Which looks like:
reference:AGTGATCAGTGGTACACCATGTACGAATTCTCGCCT GCGA
read: AGTGATCAGTGGTACACCATGTACGAATTCTCGCCTGCGAGACGA
Bowtie2 'made up' an insertion only for the purpose to fit the whole read on the reference. But I want to allow for the read to extend the reference (perhaps assign a penalty to it, but not throw in a insertion just like that). How do I do that? Can't seem to find it anywhere.
Many thanks in advance!
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Extend a read with overhang regions from alignment with a longer read
written by anicet.ebou
-
how to build bowtie2 reference sequences
written by chrisgr •
-
visualize my .BAM file in IGV
written by chrisgr •
-
Extracting Reference Sequence from Bowtie Alignment
written by eholleman •
-
Tophat vs Bowtie alignment rates
written by am3
-
mismatch setting in bowtie2
written by Bioinfonext
-
Aligning Reads with Overhangs on the Ends (Edges) of Reference Contigs or Scaffolds
written by FatihSarigol
-
Topcoat error during resuming topcoat pipeline with unmapped reads
written by lingling •
-
TopHat error during aligning reads
written by lingling •
-
RNA seq NGS data analysis
written by poonam.bi01 •
Doesn't seem bowtie2 is the correct tool for this task. What exactly are you trying to accomplish? If you are trying to extend the reference with reads, you can try
tadpole.shfrom the BBTools / BBMap package suite.Don't know if you are able to use an alternate aligner but
bbmap.shfrom BBMap suite aligns the data soft-clipping the not matching part like this