Hi. I wish to remove any sequence that is partial of a longer sequence in multifasta file. For example, let say I have three sequences below:
>seq1
ACGACGATCGT**ACTAGCATCGAGCGTAC**TACGTAGCGCGT
>seq2
**ACTAGCATCGAGCGTAC**
>seq3
AGCAGCGTACGTGACTACGACGATCTACGTATCTAGCTCGTACACT
seq2 is exactly part of seq1. So after removing the partial (duplicate) sequences, I am expecting to have the following multifasta file:
>seq1
ACGACGATCGTACTAGCATCGAGCGTACTACGTAGCGCGT
>seq3
AGCAGCGTACGTGACTACGACGATCTACGTATCTAGCTCGTACACT
All the answers I managed to search are removal of exact duplicates. Is there any tool or script to achieve the purpose? Thanks in advance.
•
written
by
Louis Kok •
1 answer
I think the most plain way would be to write a custom script using BioPython. You could create a dict with the identifiers as key and sequence as value, then test if each sequence, starting from the smallest one, is a substring of larger sequences. You can use that to pick relevant sequences and save them to an output file.
Log in to answer this question.
-
Tutorial: Yes .. BBMap can do that! - Part III clumpify (mark (and dedupe) duplicates without align…
written by GenoMax
-
how to build bowtie2 reference sequences
written by chrisgr •
-
Remove Duplicate Reads from paired end data set
written by Tonor
-
Multiple alignment processing and Visualization tool
written by ishengomae
You can try program CD-HIT with Sequence Identity Parameter = 1. It will cluster all sequences which are identical and return you longest one for each cluster.