This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove stop codon containing sequences from multifasta(DNA) files

My input multiple sequence alignments contain stop codon in the middle (TAG", "TGA", "TAA) in few sequences. I want to remove all the sequences containing a stop codon in the middle but ignoring the last stop codon. Is there any biopython or other program available? (I am Ubuntu user).

My input

>A
ATGGCAGCAGATTCCAACTAA
>B
ATGGCTAAAGATTCCAACTAA
>C
ATGGCATAAGATTCCAACTAA

Output might be

>A
ATGGCAGCAGATTCCAACTAA

Thanks in Advance

alignment
• 3,008 views • link
updated by Hugo Hugo • written by MSRS MSRS

1 answer

Dear Shaminur, you can use SEDA ( https://www.sing-group.org/seda/ ). To do what you want, you should use the Filtering operation (https://www.sing-group.org/seda/manual/operations.html#id5) and check the option 'Remove sequences with in-frame stop codons'.

If you have any question, do not hesitate ask me.

Regards.

• 0 views • link
updated by GouthamAtla GouthamAtla • written by Hugo Hugo

Thank you so much, this is very perfect one🙂

• 0 views • link
written by MSRS MSRS

Please accept the answer if its "solved".

• 0 views • link
written by GouthamAtla GouthamAtla

Log in to answer this question.

More posts like this