How to separate Miseq data and Hiseq data
Hello everyone please i have question i have a file containing Mi seq data and Hi seq data Hi seq reads starts with @HI and Mi seq reads starts with MI. like this for exemple
@HI name
ACATATATATAT
+
HJKSKSKSKSK
@MI name
TCTAGATAGGCTATCAGATGAT
+
HYUHJKKKKKJJJKKKKKKHHYH
my question is how i can separate my seq reads and Hi seq reads .
Thank you
2 answers
Log in to answer this question.
More posts like this
-
I have to extract organism and host name from a NCBI .gp file but grep code is not creating somethi…
written by oncelmiran6 •
-
what is the input i should give to GapCloser ?
written by Bioinfo •
-
best k-mer(s) to use for Mi seq and Hi seq data
written by Bioinfo •
-
how to split forward and reverse reads from sam file
written by Bioinfo •
-
The best k mer to use for illumina data
written by Bioinfo •
-
How to split fastq file containing Forward and Reverse reads to two files Forward and Reverse
written by Bioinfo •
-
Align reads files with diffrent number of reads using bowtie2
written by Bioinfo •
-
How can i extract unmapped reads using blast
written by Bioinfo •
-
Removing reads from data using Blast
written by Bioinfo •
-
Get orthologous sequences between 2 files containing a set of seq fasta
written by Chvatil
