Hi there! First of all, I hope all are safe and taking the necessary precautions amid this covid-19 situation. Now, to my question, say I have a list (or a data frame) file with regions of interest like this:
Chromosome start end
1 chr1 8827004 8827026
2 chr1 9126223 9126245
3 chr1 105687304 105687326
4 chr1 111900474 111900496
5 chr2 14439964 14439986
6 chr2 126159675 126159697
7 chr3 2429724 2429746
8 chr3 11541187 11541209
9 chr3 173421484 173421506
How can I extract those sequences from a bam file and output them in a single file (i.e. a data frame or list)?
Optimally, the final result should look like this:
Chromosome start end sequence
1 chr1 8827004 8827026 aaatgctagctagctagctagt
2 chr1 9126223 9126245 tttaagcgcgatagctagctagt
3 chr1 105687304 105687326 gagagagatcgatcgatcgatgc
4 chr1 111900474 111900496 gcatcgatgcatgcatgcatggg
5 chr2 14439964 14439986 gggctagctagctagcatatatt
6 chr2 126159675 126159697 aaaatttttcttcgagatcgcta
7 chr3 2429724 2429746 tatatatatcgcgatgctagcag
8 chr3 11541187 11541209 gggtagataccccctatacttta
9 chr3 173421484 173421506 ggcatgctagcctacgatcatcg
But if generating a separate file just for the output sequences, that is also ok.
I have tried using samtools, such as below:
samtools view input.bam chr1:9126223-9126245 > output.bam
But it doesn't work. For one thing, the sequences are too short, so samtool view doesn't catch anything. And second, this command retrieves all mapped sequences that falls within the specified region.
I am quite sure that I am not on the right track here, so if anybody could help, that would be really good.
Thank you and again, I hope you are all safe and doing well.
0 answers
No answers yet.
Log in to answer this question.
do you want to extract the reads or the sequence of the reference genome at these regions ?
I would like to extract the sequence of the bam file; it is, the consensus sequence of the given bam file.
Question already answered then : Generate consensus from BAM file