so, we no need to use sorted-bam file for that command or we can use sorted.bam file only for the step. I am also facing same issue.
hello, when i run gatk, the error always occur, like this "java.lang.IllegalArgumentException: samples cannot be empty" is there mistake in my input file? thank you for your help !
my bam file as following: HWI-EAS418:3:37:1070:1462 83 chr20 46689301 255 50M = 46687222 -2129 CAGCTCCAGGCCGCTCAAGAAGCGGCTGCTCCGCTCCCGGGCTGCGGCCA 0:@2%,6.=:.4=,4+6;B79>=BB=2>7=:9=4(599@BB9BB>BB??A NH:i:1 HI:i:1 AS:i:99 nM:i:0
the script is following: java -jar /home/H/mutation/gatk/gatk-package-4.1.4.1-local.jar HaplotypeCaller -R /home/H/mutation/ref/ctat_genome_lib_build_dir/ref_genome.fa \ -I /home/H/mutation/ctat-mutations-master/testing/__misc_data/Aligned.sortedByCoord.out.GRCh38.bam \ --recover-dangling-heads true \ --dont-use-soft-clipped-bases \ -stand-call-conf 20.0 -O test.vcf
the logs are followinig: Runtime.totalMemory()=2260729856 java.lang.IllegalArgumentException: samples cannot be empty at org.broadinstitute.hellbender.utils.Utils.validateArg(Utils.java:725) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.ReferenceConfidenceModel.<init>(ReferenceConfidenceModel.java:116) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.initialize(HaplotypeCallerEngine.java:221) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.<init>(HaplotypeCallerEngine.java:164) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCaller.onTraversalStart(HaplotypeCaller.java:224) at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1046) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210) at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:163) at org.broadinstitute.hellbender.Main.mainEntry(Main.java:206) at org.broadinstitute.hellbender.Main.main(Main.java:292)
5 answers
I had the same problem, I had to add the read group @RG tag to the .bam file using
samtools addreplacerg -r '@RG\tID:samplename\tSM:samplename' input.bam -o output.bam
What tags of BAM are required ? thank you
hello,have you solved the problem?? I have the same problen as you.
Same problem
Maybe you used bam file sorted by name in last step.
samtools sort -n bamfile.bam (x)
Log in to answer this question.