This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RefSeq/other ID to Gene ID conversion

I have a list like:

ID adj.P.Val P.Value logFC SEQUENCE

ASHGA5P025665 2.06e-12 1.35e-16 -6.333.437 CAAGAACAAGACTGGATCACTCCATGTCAGTGGAAACATGTCCACCAACTTCATCATTGT ASHGA5P016911 1.59e-11 2.08e-15 -7.366.312 TTTCTGAAAGGCTCTGCTTTGACCTGAAGTATTTTATCTATCCTCAGTCTCAGGACACTG

This is corresponding a list of genes and I need to obtain the official gene name. I tried DAVID tool and similars, but not successful. How can I obtain the official gene name of a list of 20.000 genes ID's like showed above?

Thanks all.

rna-seq gene sequence geneid genename
• 2,648 views • link
updated by GenoMax GenoMax • written by DANIELBASTOS.ADM • DANIELBASTOS.ADM

Hi, I have a list of genes like MD00G1000100 and would like to convert it to ENTERZID (103435615) or LOC103435615. I tried DAVID but failed. Is there any other website where I can get it converted? Thank you.

• 0 views • link
written by sangi • sangi

This question is not related to the original parent and should be asked as a separate question. Please indicate where you got these ID's from and what organism they belong to when you create the new question. Then come back and delete this post.

• 0 views • link
written by GenoMax GenoMax

1 answer

This appears to be from Arraystar human lncRNA microarray V3 which contains a mixture of lncRNA and protein-coding genes.

I'm unsure on how to find the official annotation for the lncRNA, but for the protein-coding genes, the NCBI (entrez) gene IDs are located in this file: https://www.ebi.ac.uk/arrayexpress/files/A-MTAB-619/A-MTAB-619.adf.txt

(In that file above, the first column contains the probe ID and the last column contains the gene ID if it's a protein-coding gene).

As for the lncRNA, here are some ideas (hopefully, if someone else has a better alternative, they can chime in):

  1. GENCODE has lncRNA annotations. However, it might take quite a bit of work to map between the sequences provided in your microarray file and the annotations in the GENCODE file. But, in any case, here's the annotation file: ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_19/gencode.v19.long_noncoding_RNAs.gtf.gz
  2. You can do a search for previous studies that have attempted to annotate lncRNA arrays. As an example, see Paul Y, Thomas S, et al., Oncotarget 2018: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6049862/ - Look in the Supplementary Tables which have annotated some of the ArrayStar lncRNAs. (Caveat: I haven't looked at the paper in detail, so I don't know how comprehensive the annotation is nor can I attest to its accuracy, and there are probably several other papers that used the same array and attempted to annotate the lncRNAs.)
• 0 views • link
written by dsull dsull

Log in to answer this question.

More posts like this