Hello, I want to align short sequences that contain Ns to a genome, but I want to preserve the number of Ns and not allow gaps or mismatches. For example -

CTCGAGNNNNNNATGTGG

I know matches exist -

$ grep 'CTCGAG......ATGTGG' OlGenomev3.fasta
TAACGATGGCAAAAGGAAAG**CTCGAGCCAAGCATGTGG**ACGATATATAATACGATCAAGG
TATTGATGTTACGAATGCGTGATAAATTAACAAATAATTC**CTCGAGCGTAAAATGTGG**GT

But I have not been able to recover them as an alignment with blast or bwa. The above example excludes any matches lost by a line wrap. What is the best way to do this with an alignment program?

bwa aln -e 1 -e 6 -t 4 -M 1 -O 1 -E 1 Oligv3BWA ./BrookeGenes/BrookeSeqs.fasta > test3.bwa

and

blastn -query Seqs.fasta -db ../OlGenomev3.fasta -task 'blastn-short' -max_target_seqs 5 -word_size 4 -outfmt "6 qseqid sseqid qlen length qseq sseq pident sstrand" -gapopen 10 -penalty -1 -out SeqsXOlv3.csv

Return no matches.

Thanks-