Aligning short oligos containing Ns to a genome
Hello, I want to align short sequences that contain Ns to a genome, but I want to preserve the number of Ns and not allow gaps or mismatches. For example -
CTCGAGNNNNNNATGTGG
I know matches exist -
$ grep 'CTCGAG......ATGTGG' OlGenomev3.fasta
TAACGATGGCAAAAGGAAAG**CTCGAGCCAAGCATGTGG**ACGATATATAATACGATCAAGG
TATTGATGTTACGAATGCGTGATAAATTAACAAATAATTC**CTCGAGCGTAAAATGTGG**GT
But I have not been able to recover them as an alignment with blast or bwa. The above example excludes any matches lost by a line wrap. What is the best way to do this with an alignment program?
bwa aln -e 1 -e 6 -t 4 -M 1 -O 1 -E 1 Oligv3BWA ./BrookeGenes/BrookeSeqs.fasta > test3.bwa
and
blastn -query Seqs.fasta -db ../OlGenomev3.fasta -task 'blastn-short' -max_target_seqs 5 -word_size 4 -outfmt "6 qseqid sseqid qlen length qseq sseq pident sstrand" -gapopen 10 -penalty -1 -out SeqsXOlv3.csv
Return no matches.
Thanks-
• 1,264 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Not sure about BLAST but most NGS aligners consider ambiguous (non-ATCG) characters as mismatches. In you example 6/18 so 33% are mismatches and centered in the read. I do not see how this is ever going to be a valid alignment at that short query length.
Hi, If your file is not too big than you can try this command. Here your query sequence will act as a motif so it preserve "Ns"
You can modify the command according to your requirement.
Hoping it may help you.