I am getting this error on running CPAT
cpat.py -g merged.fa -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.log
Traceback (most recent call last): File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 241, in <module> main() File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 229, in main print >>sys.stderr, "Input gene file is in FASTA format" TypeError: unsupported operand type(s) for >>: 'builtin_function_or_method' and '_io.TextIOWrapper'. Did you mean "print(<message>, file=<output_stream>)"?
No matter what format the input file is BED or FASTA, the error is persistent? Anyone else facing this error?
•
written
by
Hyper_Odin
I just tried the webserver with a fasta file and it worked fine so the problem is most likely your fasta file. From the error message I would look for cases where there are double ">" in the title of a sequence (e.g. ">>").
Can you post the fasta file here? I downloaded a small fasta file from ucsc and tried, but it still doesn't work!! :(
It's just a standard fasta file with the nucleotide sequence. If you want more help you would need to post (parts of) your file.
Hello, I got the same error can you resolve it Sample fasta
MSTRG.1687.1 GGCTTATTCTTTACTTTTTCCCACTTTTCCAGGCTCAGCGGGGAGCTGTTGGATGAGAAAGAGCCTGAAGTCTTGCAGGAGTCACTGGATAGATGCTATTCAACTCCTTCAGGTTGTCTTGAACTGA CTGACTCATGCCAGCCCTACAGAAGTGCCTTTTACATATTGGAGCAACAGCGTGTTGGCTTGGCTGTTGACATGGATG
Log in to answer this question.
To determine if it is the software or the file that is the problem would you try running (part of) the fasta file via their webserver?
Nope! The web server shows error while uploading. Tried uploading BED and FASTA format. The website is sending requests, but I guess the server is not responding.