Problem solved then, good job ;)
Hello,
I am trying to run MEME-chip and I am experiencing problems with centrimo and spamo.
These two packages fail with Errror:
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
FATAL: Template does not contain data section.
The centrimo was run as
centrimo --oc MEME/Test/centrimo_out --verbosity 1 --score 5.0 --ethresh 10.0 --bfile MEME/Test/Cluster_7.fa.bg MEME/Test/Cluster_7.fa /home/s1469622/dstore/motif_databases/JASPAR/JASPAR2018_CORE_vertebrates_non-redundant.meme /home/s1469622/dstore/motif_databases/MOUSE/uniprobe_mouse.meme
When I upload my fasta file on the web service everything works. The generated background file is identical to mine so I do not understand why it is failing.
Could you please help me with this?
Background file:
# 1-order Markov frequencies from file MEME/Test/Cluster_7.fa
# seqs: 1956 min: 500 max: 500 avg: 500.0 sum: 978000 alph: DNA
# order 0
A 2.487e-01
C 2.513e-01
G 2.513e-01
T 2.487e-01
# order 1
AA 7.168e-02
AC 5.016e-02
AG 7.936e-02
AT 4.752e-02
CA 7.227e-02
CC 7.526e-02
CG 2.443e-02
CT 7.936e-02
GA 6.274e-02
GC 6.313e-02
GG 7.526e-02
GT 5.016e-02
TA 4.200e-02
TC 6.274e-02
TG 7.227e-02
TT 7.168e-02
Example of Fasta
>chr1:3914040-3914540
ACTATTTTAAGTATCTGCTGTTTGGAATGGAGGCCACAGTCTGTATTTAACAGATTCTGCCACAGAATTTTTATAAGCCCAAGAAGAAGGAAAATTTCAATCTATATTGTTATATCCACTTTGATTTCTTTCAAATTATTCCAGCTCTAATCTTATGTGCAACAAGGAGCACAATGCCTTAACAGATGCAGAATGACATTCTTTGTCAACACAGGCTCTTTGCTTTTCTTTTGCAAATGCCAATGTCCAGCAGATAATTGTCATTTAGAAAGTGATGTATTATGAAGTTAATCAACCTTTTATAATTGAGGTTTTCCTTTCCTCTGTTTGCCGGATGAATTCAGTACCCCAGAATTTCTCATCACAGAAGGAACaaaaaaaaaaaaaaaaaaaaaaCCAACAACCAAAAAAATAATCATCTTTTCCCCTAATCTTAAGTTTATACACAATACCCTTTCACTTAGTAATTCAAGGTGGCTTCATTAGTCCAACATGTCCAG
>chr1:4857339-4857839
TGTCATTTTTTTACCGTGGCTTTTTTTAAGTCACAATTCTCAAGGCCGTCGTCTTTTTAGTCGGTTTTCATCAGCAGGCTAGATGGTTTGAATATCTGAGTCCAAGAGTGAGCCTCAGTGCTCATGCGCTTTAAGCCCTCGGCAATGCCTGTCCTGCGTCCCAGAGAACGCTCTGCCGGAGGGGTTTCGATGGAACTCGTAGCAACCTACCGCCTACTGCCTGATCCCTCTGGCGTGAAAGCCGGACTCCGTCCAACTCCAGCTCGCCAGCAACGCGAGTCCGGATAGGGCCGGAAGTTCCAGACTGCTGGGGGCGGGAATAGATTAAAAGAACAGCGCACGCCTGAGCGAGCCACTTCTACTTTCCAGTCTCCTGCGATCGATTCGTAGTGCCTGTGTGGCGCGCGCGGTGCTTGACTGGCACGGCCTAGGGGGCGGAGCGCTTATCCCTGCCGCCGCGGGCCGGGTCTGTGAGGAAGGCCTAGGCCAGCGGCTTCGCG
>chr1:4972323-4972823
caaaaGGGAGGCAGAGGGAGACAGAGACTGAGAAAGACAGACTGTTAGTTATCTTCAGCTTCTCCACTTCTAACTCAGCAAAACCAAATGAGCTTTCTATATCCCAGAAGCCTTTTGACTTTATCTTGACCTTGGGCCTAGATTTTGATGGAAATTTCTCTGTAATCCTGTTTCTGTTCTTCCTTTGAATAACTAAAGAAATGTAAAACTGTTGACCTTTTAGAGCATTGTACTCAGTCTTTCTCCCTCTGAAGCAGTGGAAATAAGACTTAGGTAGAAAGGTTATTGATTTCCGGTCAAGTGTGTACTGACTGCAAAGCCCCTTTCATTGTGGGCAGCTAAGAAGGTAAATGCGgttcctctttctccacatccttgccagcatctgctgtcacctgaacttttgatcttagccattctgactgctgtgaggtggaatctcagagttgttttgatttgcatttccctgatgtttaaggatgttgaacattttttcaggt
>chr1:7052296-7052796
ATGGATTGCCTTGCTTttctttctttctggacaggtcctcaagtggtattccaggccagtcacggactcataatgtattttaggctggcctgcagtttacagcctcagcttctacagtgctagctggtgttagatttcaacccccacccccccaacaaatgcacaatgtacctatttaacatattcaagccgactaagatctccctgcatcctgcaggccctacctgctaccctacttgctacagggttgtcataccctgcccccaccctgagttctccatctctaggggatgagctgcccttcccttagctactcttctctGAtgttgattttcaaagctgagacaactggccgaggtgcctatttatcatatcaagctgaccaggttaccaggttctcccaacgtccctcagtcactttctacttgttacaaggtgtggctagcattttataccctctaccctgagctctgtcactggggctttgctgctcttctgcc
>chr1:7297803-7298303
ctgtgttttttcacaaaaagaagacagagcatgatggctgcctgagagattagttcgtcaactggacacagatcctgaatcttctagtaagtatgactctaaccttgattatggttaaaaaccctctttagctgaaaagttaatttggagcacagcctccactcccagagcagcctttctgcaattctcaaagtcacctccctcacatcgggagctctaagtctaagccgcctgatcgttgctcatttgcaactgaagggattacctggactttcccaaagaagcttttgtactgttgcttttcactgtcttgactttgtttttcaagcaggtcagtcaatgcccttcagcctgactgcagcaagcatgcatccctgcctccaacagtgcagatggcgttattaatcttcattcaagaagcattctaagtatatattgtggcttttggtctgatttgggaataaggtttgctatgagagccagacagtctaagataggca
4 answers
Hello,
I emailed developers of meme-suite and they pointed that the error comes from centrimo or spamo being able to access template html file. This suggests that the conda installation of meme did not worked properly.
I have solved the problem by installing meme-suite using
conda install -c bioconda/label/cf201901 meme
instead of
conda install -c bioconda meme
Matus
it works. Thanks!
I tested, ame and centrimo commands failed in meme 5.0.5 in conda version.
Thanks for this. conda install 'meme=5.0.2' 'icu=58.2' may be more explicit than conda install bioconda/label/cf201901 meme
Hello, I am having exactly the same error when trying to run AME with motif files (in .meme format) downloaded either from JASPAR or MEME. Using the alternative conda install (conda install -c bioconda/label/cf201901 meme) did not help. Has anyone had the same issue and solved it?
Update after 40 minutes ... conda install -c bioconda/label/cf201901 meme did not work, but conda install 'meme=5.0.2' 'icu=58.2' worked (thanks! dariober). It looks like an older version of meme (that requires a conda environment with python 2.7) but at least it runs...
Dear Matus and Dario. Thank you for the explanation.
If any useful, this is how I installed the latest meme (5.3.0) using a mixture of conda and source code
Create a conda environment with these dependencies:
- python >=3.0 - perl =5.22.0.1 - zlib - ghostscript - perl-xml-parser - perl-yaml - perl-xml-simple - perl-html-template - perl-cgi - perl-html-parser - perl-html-tree - perl-math-cdf - perl-log-log4perl - perl-json - perl-file-which
I think the perl version perl =5.22.0.1 is important because of this (bio)conda issue
In the new conda envirnoment, download, compile and install meme:
DIR=/full/path/to/your/installation/dir rm -f meme-5.3.0.tar.gz rm -rf meme-5.3.0 wget http://meme-suite.org/meme-software/5.3.0/meme-5.3.0.tar.gz tar zxvf meme-5.3.0.tar.gz rm meme-5.3.0.tar.gz cd meme-5.3.0 ./configure --prefix=$DIR --with-url=http://meme-suite.org --enable-build-libxml2 --enable-build-libxslt make clean make &> make.log make test &> test.log || true make install &> install.log export PATH=$DIR/bin:$DIR/libexec/meme-5.3.0:$PATH meme-chip -version tomtom -versionBefore using meme, execute
export PATH=$DIR/bin:$DIR/libexec/meme-5.3.0:$PATH
or add those paths to your profile.
I went through all the comments and the solution for me was to use docker (recommended by the MEME team). I have Ubuntu LTS 20.04 and here is how I installed docker and the meme-suite (version 5.5.5):
# Install docker (see https://phoenixnap.com/kb/install-docker-on-ubuntu-20-04)
sudo apt update
sudo apt install apt-transport-https ca-certificates curl software-properties-common -y
curl -fsSL https://download.docker.com/linux/ubuntu/gpg | sudo apt-key add -
sudo add-apt-repository "deb [arch=amd64] https://download.docker.com/linux/ubuntu $(lsb_release -cs) stable"
apt-cache policy docker-ce
sudo apt install docker-ce -y
sudo systemctl status docker
# Install meme
sudo docker pull memesuite/memesuite
# Launch meme as a local web server (see https://hub.docker.com/r/memesuite/memesuite)
sudo docker run -v `pwd`:/home/meme -d -p 8080:8080 memesuite/memesuite:latest
After 5 minutes, I browsed http://localhost:8080/meme_5.5.5 and I could use meme-chip with Centrimo working. All databases are already available after this installation.
Hi again, I see what is causing the error.
It looks like your database JASPAR2018_CORE_vertebrates_non-redundant.meme needs some reformatting. For each motif you provided, I just truncated header line, setting letter-probability... as a second line, i.e.:
MEME version 4
ALPHABET= ACGT
strands: + -
Background letter frequencies
A 0.25 C 0.25 G 0.25 T 0.25
MOTIF MA0004.1 Arnt
letter-probability matrix: alength= 4 w= 6 nsites= 20 E= 0
0.200000 0.800000 0.000000 0.000000
0.950000 0.000000 0.050000 0.000000
0.000000 1.000000 0.000000 0.000000
0.000000 0.000000 1.000000 0.000000
0.000000 0.000000 0.000000 1.000000
0.000000 0.000000 1.000000 0.000000
URL http://jaspar2018.genereg.net/matrix/MA0004.1
MOTIF MA0006.1 Ahr::Arnt
letter-probability matrix: alength= 4 w= 6 nsites= 24 E= 0
0.125000 0.333333 0.083333 0.458333
0.000000 0.000000 0.958333 0.041667
0.000000 0.958333 0.000000 0.041667
0.000000 0.000000 0.958333 0.041667
0.000000 0.000000 0.000000 1.000000
0.000000 0.000000 1.000000 0.000000
URL http://jaspar2018.genereg.net/matrix/MA0006.1
MOTIF MA0019.1 Ddit3::Cebpa
letter-probability matrix: alength= 4 w= 12 nsites= 39 E= 0
0.358974 0.179487 0.307692 0.153846
0.282051 0.179487 0.358974 0.179487
0.461538 0.076923 0.384615 0.076923
0.000000 0.025641 0.000000 0.974359
0.000000 0.000000 0.974359 0.025641
0.102564 0.846154 0.000000 0.051282
0.974359 0.025641 0.000000 0.000000
0.923077 0.051282 0.025641 0.000000
0.000000 0.153846 0.000000 0.846154
0.358974 0.435897 0.128205 0.076923
0.102564 0.589744 0.230769 0.076923
0.000000 0.666667 0.153846 0.179487
URL http://jaspar2018.genereg.net/matrix/MA0019.1
I also set URLs as separate lines, though this does not seem to be required. After these changes, I could get results with:
centrimo --oc centrimo_out --verbosity 1 --score 5.0 --ethresh 10.0 --bfile Cluster_7.fa.bg Cluster_7.fa uniprobe_mouse.meme JASPAR2018_CORE_vertebrates_non-redundant.meme
By the way, some months ago I retrieved Jaspar Core (2018) matrices from here (downloaded as a folder containing single PSWMs, condensed in a file using (from that folder): for e in *.meme; do cat $e >> JASPAR2018_CORE_vertebrates_non-redundant_pfms_meme.meme; done).
Hope this helps!
Hello Anima,
Thank you very much for your help.
Unfortunately, formatting The database didn't help.
I even reinstall my conda but it didn't help either I am really clueless at this point.
Mmm, I see. Using the Jaspar database I suggested on your minimal example fixes the problem? And using uniprobe_mouse.meme only?
Log in to answer this question.
Hi, not sure if this might help you. A quick-and-dirty version of your command yields an output without problems for me, albeit with no enriched motifs for the sample sequences you provided. Here is what I tried:
centrimo --oc centrimo_out --verbosity 1 --score 5.0 --ethresh 10.0 --bfile Cluster_7.fa.bg Cluster_7.fa uniprobe_mouse.memeHello Anima,
Thank you for your reply. I think the problem is in the motif database because the minimal example I provided gives me an error and the only difference is the meme database.
Could you give me an example how it should look like? I downloaded mine from: http://meme-suite.org/doc/download.html The top 50 lines of JASPAR2018_CORE_vertebrates_non-redundant.meme