How to get the reads with significant RPM?
I am doing small RNA quantification, I have data of 338 lines (samples). Till now i have count the RPM values but I want to extract the reads with RPM value >= 0.6 , and appears more than 60 times in all lines. Please provide me any method or script to perform this step. Thanks. data file is bed format and looks like.
ReadsID Line1 Line2 Line3 and so on
AAAAAAACAAAATTCGGTTGCTCT 0.166426748639607 0.166426748639607 0.166426748639607
AAAAAAACAACTACCTCTTGTCCT 0.74444666 0.04544645645 0.043534534
• 1,375 views
•
link
0 answers
No answers yet.
Log in to answer this question.
We are volunteers and are not simply going to give you the solution to any problem you might have. You'll have to show some effort and show us that you tried to solve this yourself before asking for help.
A solution would be to use R or Python for filtering your file, or probably someone can come up with an awk one-liner.