This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Is there a way to get multiBigwigSummary with 1-based coordinates instead of 0-based?

Dear Biostars commmunity,

I am seeking your advice to know if there is a way to overlap chip-seq scores distributed across 0-based consecutive genomic bins (generated by Deep tools multiBigwigSummary) onto expression scores generated for RNA-seq data distributed in similar consecutive genomic bins, which are instead 1-based coordinates (generated from HTseq)? Are they already comparable as they are?

illustration of my question:

multiBigwigSummary chip-seq scores in 0-based genomic bins:

chr1     0      10000   0.9402239918708801  "bin 1;"
chr1    10000   20000   0.7390850186347961  "bin 2;"
chr1    20000   30000   0.35219499468803406 "bin 3;"

HTseq rna-seq scores in 1-based genomic bins:

chr1    1       10000   0.5 "bin 1;"
chr1    10001   20000   1.2 "bin 2;"
chr1    20001   30000   1.8 "bin 3;"

Thanks a lot for your help!

deeptools multibigwigsummary
• 1,858 views • link
written by Zee_S Zee_S

Why not just to modify your multiBigwig file to be 1-based? You already compute the bins, coordinates representation is just where the range is located.

• 0 views • link
written by JC JC

hi JC, thanks a lot for your answer. How exactly do i do that? i was thinking that if i modify the multi bigwig coordinates to 1-based, the score in column 4 that was calculated for the original 0-based coordinate will no longer be valid (since now the 1-based causes the bin to shift by 1 base pair?). or am i wrong?

• 0 views • link
written by Zee_S Zee_S

Coordinates are just representation of the positions, for example:

ACGTTGACAATTAGGATATGATAG
01234567890123456789  <- 0-based
12345678901234567890  <- 1-based

The coordinates can be represented as:

chr    0    5      XX    "bin 1"      <- 0-based
chr    1    5      XX    "bin 1"      <- 1-based
• 0 views • link
written by JC JC

understood. thank you so much for your help!

• 0 views • link
written by Zee_S Zee_S

0 answers

No answers yet.

Log in to answer this question.

More posts like this