This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BAM files just say "sample_ID"

None of my BAM files have a correct sample ID in their header, they all literally say "sample_ID"

I didn't catch this until after SNP calling. How can I get the BAM headers to have the name of the sample that they are? I have over 2,000 BAM files.

bam snp samtools
• 859 views • link
written by marcus.hooker • marcus.hooker

Yikes ...............

Did the original file names have this information? You could perhaps samtools reheader the files in that case.

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Split multifasta-file into multiple files according to a pattern in header
    written by 6schulte • 6schulte
    I am trying to `split a multifasta` file into several smaller mutlifasta files. This should be done `according to a string in the header of …
  • correct header with samtools mpileup
    written by storm1907 • storm1907
    Hello, Samtools Mpileup does not generate correct headers Have error, when piling several files in the folder with `samtools mpileup -A -E -f $reference $INPATH/*.bam …
  • Change header fastq files
    written by riccardo.scotti82 • riccardo.scotti82
    Hi all, My original fastq files heve the followig header format: @000e86e5-6b4a-4e28-9e4d-67c4e41987f5 runid=99d90dd5f9459ef0df31d28d69ecc5852c85f135 read=1061 ch=119 start_time=2019-08-17T03:58:38Z flow_cell_id=ABB818 protocol_group_id=xxx_B2_D2_H12_13112019 sample_id=xxx_B2_D2_H12_13112019 GTTGTGCTGTTCGGTTTCGTTTGATTGTTTGCTCGGTTGCTCGCCCTAAGCGACAAGAAAGTTGTCGGTGTCTTGTGCGTTTTTCGTGCGCCAACCTGTGTTGCTTCAAGCTGG + )0/%$$#'&320')))(&%#$$%#$%'#$%$#&,$&%$$#(/-..)'%&%&'&$$$(1//56<868'0.-,-&&$('04BBC;@7.<1*)(&$%$$(%&%&'$"#%#$%*++'&$$#( After running minimap2, …
  • GATK GetSampleName is not working?
    written by imanthony1993 • imanthony1993
    Hi. Recently I am running a tumor-only SNV calling pipeline and encounter a problem when running GATK GetSampleName. In the tutorial (https://software.broadinstitute.org/gatk/documentation/tooldocs/current/org_broadinstitute_hellbender_tools_GetSampleName.php), the code is …
  • BCF missing sample names
    written by marcus.hooker • marcus.hooker
    I called SNPs with bcftools mpileup and I had 120 input sample files, my command looked like this, bcftools mpileup -d 8000 -f Reference.fasta -Ob …
  • SNP calling with SAMtools on multiple samples
    written by madeira.ag • madeira.ag
    Hello. I found similar questions here, but couldnt find exactly what I am searching for. I have several (+180) .bam files, each from a different …
  • Bam header editing
    written by Huynh Nguyen • Huynh Nguyen
    Dear all, I have 100 .bam files and I would like to change all their header with a new header. The new header is the …
  • how to split a coordinate-sorted bam file by read group
    written by jing.mengrabbit • jing.mengrabbit
    Hi, I have a coordinate-sorted bam file, and its read group information in the header is: @RG ID:0 PL:ILLUMINA SM:COLO829_Normal_Tgen PU:H0CGCADXX:1:none @RG ID:1 PL:ILLUMINA SM:COLO829_Normal_Tgen …
  • reheadering, merging and sorting on different bam file
    written by khikho khikho
    Hi, Imagine that I have 20 bam files, which I want to change their header then merge them and then sort them! So I just …
  • Gatk Multi-Sample Calling
    written by Bioscientist Bioscientist
    <p>I just want to know if my understanding is correct or not.</p> <p>So for multi-sample,to use GATK for SNP/indel calling, what I should do is:</p> …