gggggaattggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctgcggacataaagc
Ex- I have like this whole fasta sequence . i want to extract particular sequence like if i want 5 to 20 sequence only from my fasta sequence. then how i extract those sequence. thanks
•
written
by
harry •
3 answers
You can use a tool called fastx. Use fastx-trimmer and give it the start and end position of your selection (in your case 5 to 20).
fastx_trimmer -f 5 -l 20 -i input.fasta -o output.fasta
See here for the instructions.
http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_trimmer_usage
It is not clear if you want to cut the sequence you pasted above from your sequences or if you just want to identify fasta sequences that contain that sequence. In either case you can use bbduk.sh from BBMap suite to do either. A guide is available here. Sequence you are looking for can be provided via a file or using literal=actual_sequence option.
What you are showing is not a valid fasta file, because the id is missing.
Assuming you have my.fasta file with this content:
>my_sequence
gggggaattggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctgcggacataaagc
You can use samtools faidx
$ samtools faidx my.fasta my_sequence:5-20
Log in to answer this question.
-
How do I extract a fasta sequence using the specific keyword (**Psychro**) ?
written by sunnykevin97
-
remove the fasta sequence which doesn't contain ATGC
written by harry •
-
Fasta header contain multiple string
written by harry •
-
extract fasta sequence with the help of bedtools getfasta
written by harry •
-
Want to reverse the fasta sequence
written by harry •
-
trimming of fasta file
written by harry •
-
Script for making exon file
written by harry •
-
Extract every CDS sequences from a VCF file
written by maxime.policarpo
-
How to create custom gtf annotation file?
written by John
-
fasta generation for functional elements
written by ajmaninisha •
