This is a test version of Biostars. For the public version, visit https://www.biostars.org.
UTR sequence extraction

How can I extract the 5' and 3' UTR sequences of a list of gene IDs using BiomaRt R package?

sequence r
• 2,550 views • link
updated by h.mon h.mon • written by ezraamustafa3 • ezraamustafa3

1 answer

Probably the biomaRt user guide covers your question. For example, it has an example showing how to Retrieve all 5’ UTR sequences of all genes that are located on chromosome 3 between the positions 185,514,033 and 185,535,839.

• 0 views • link
written by h.mon h.mon

Thanks a lot. I tried this one but it is limited to a specific chromosome and position. What am interested in is to have the UTRs sequences of a list of human genes that aren't loaded on the same chromosome to be able to count the GC content for each UTR alone. If you can help to figure out how to do this using R I'd appreciate.

• 0 views • link
written by ezraamustafa3 • ezraamustafa3

(following h.mon) Try:

library("biomaRt")

ensembl <- useMart("ensembl", dataset = "hsapiens_gene_ensembl")

ID <- "ENST00000429510.1"
getSequence(
  id = ID,
  seqType = "5utr",
  type = "ensembl_transcript_id_version",
  mart = ensembl
)
getSequence(
  id = ID,
  seqType = "3utr",
  type = "ensembl_transcript_id_version",
  mart = ensembl
)

Which returns:

> getSequence(
+   id = ID,
+   seqType = "5utr",
+   type = "ensembl_transcript_id_version",
+   mart = ensembl
+ )
                                     5utr ensembl_transcript_id_version
1 ATTCTTGTGAATGTGACACACGATCTCTCCAGTTTCCAT             ENST00000429510.1
> getSequence(
+   id = ID,
+   seqType = "3utr",
+   type = "ensembl_transcript_id_version",
+   mart = ensembl
+ )
                                                                                                                                                                                                                                                                                                                                                                                   3utr
1 GACGCAGAAGAAACATGTCCTTCATTCACCAGGCTGAGCTTTCACAGTGCAGTGGTTGGTACGGGACTAAATGTGAGGCTGATGCTCTACACAAGGAAAAACCTGACCTGCGCACAAACCATCAACTCCTCAGCTTTTGGGAACTTGAATGTGACCAAGAAAACCACCTTCATTGTCCATGGATTCAGGCCAACAGGCTCCCCTCCTGTTTGGATGGATGACTTAGTAAAGGGTTTGCTCTCTGTTGAAGACATGAACGTAGTTGTTGTTGATTGGAATCGAGGAGCTACAACTTTAATATATACCCATGCCTCTAGTAAGACCAGAAAAGTAGCCATGGTCTTGAAGGAATTTATTGACCAGATGTTGGCAG
  ensembl_transcript_id_version
1             ENST00000429510.1

Combination of 5.7 and 5.8 with "ensembl_transcript_id_version" as type. :-)

• 0 views • link
written by AK AK

Log in to answer this question.

More posts like this