This is a test version of Biostars. For the public version, visit https://www.biostars.org.
MaSuRCA, Flye assembly error

Dear Biostars,

I need your help. I am running MaSuRCA for the Paired end reads with nanopore plus pacbio in one file for bacteria organism.

DATA

PE= il 75 11 /../../R1.fastq /../../R2.fastq (of course I am using a full path)

NANOPORE= /../../../both_longreads.fastq (of course I am using a full path)

END

Parameters in the config file:

PARAMETERS

EXTEND_JUMP_READS=0

GRAPH_KMER_SIZE = auto

USE_LINKING_MATES = 0

USE_GRID=0

GRID_ENGINE=SGE

GRID_QUEUE=all.q

GRID_BATCH_SIZE=500000000

LHE_COVERAGE=25

MEGA_READS_ONE_PASS=0

LIMIT_JUMP_COVERAGE = 60

CA_PARAMETERS = ovlMerSize=30 cgwErrorRate=0.25 ovlMemory=4GB

CLOSE_GAPS=1

NUM_THREADS = 10

JF_SIZE = 160000000

SOAP_ASSEMBLY=0

FLYE_ASSEMBLY=1

END

I am getting an error on the "Assembly with flye failed" step:

[2019-06-25 20:42:03] root: INFO: Starting Flye 2.4.1-release

[2019-06-25 20:42:03] root: DEBUG: Cmd: /bioappl/src/MaSuRCA/MaSuRCA-3.3.3/bin/../Flye/bin/flye -t 6 --nano-corr mr.41.15.15.0.02.1.fa -g 7566250 --kmer-size 21 -m 2500 -o flye -i 0

[2019-06-25 20:42:03] root: INFO: >>>STAGE: configure

[2019-06-25 20:42:03] root: INFO: Configuring run

[2019-06-25 20:42:04] root: ERROR: Invalid char while reading mr.41.15.15.0.02.1.fa

I have no idea what to do now? I would be very glad for any help, Dorota

assembly genome assembly

ERROR: Invalid char while reading mr.41.15.15.0.02.1.fa

Looks like you need to check that file. Does it have anything other than ACTG in sequence?

Thank you Genomax:) You are totally right, however, I have no idea how it appears:

m54293_190222_151630/43319410/0_37246.33848_2905 ACGGAAGGCGGCCCAGCATCTCGCGGCTTTGCAGCAGTTCCAGCACGGTCTCGCGCCAGTGGTCGGCTCAGTTTGTCGATTCCGTTGAGCGTCATTCCGTCCAGGTTGGCGCGGATCTCGAACCGCATGCCGTCGCCGACCGGATAGGACTTCGGGAAGATGTAGCGGATGATGAATTCCCCGTCGTATTperl: warning: Setting locale failed.perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_US.UTF-8" are supported and installed on your system.perl: warning: Falling back to a fallback locale ("en_US.UTF-8").

Each run at the server is showing me that

[Tue Jun 25 20:36:28 CEST 2019] Running locally in 1 batch

perl: warning: Setting locale failed.

perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_US.UTF-8" are supported and installed on your system.

perl: warning: Falling back to a fallback locale ("en_US.UTF-8").

it should be removed by the server administrator? Or? It is unbelievable that those Warnings appeared at the end of almost all sequences in the file mentioned above.

Have you opened/edited any of these files on Windows and then moved them to linux? Perhaps it may just be a matter of doing dos2unix your_file.fa to fix the line endings.

No, I am using the only Linux. Thx, I will do a line fixing. However, I do not know if after editing the file MaSuRCA will run from the moment it stopped? Now I know I really need to "fix" the warnings, that are influencing on my assembly:). Thank you Genomax again, a lot:) I would never think those warnings are inside the file and disrupt my data and analysis.

The problem is not fixed. The file:

mr.41.15.15.0.02.1.fa

does not contain any invalid char anymore, and still I am getting the same error:

ERROR: Invalid char while reading mr.41.15.15.0.02.1.fa

Maybe someone have idea what to do?

Hi Corentin, actually the admin of the server already fixed the:

"Please check that your locale settings: LANG = "en_US.UTF-8" are supported and installed on your system"

After fixing the Perl issue, still nothing changed with the error from the Flye assembly. However, it changes with the mr.41.15.15.0.02.1.fa file where I had the Perl: warning before. Now the file contains only sequences.

I do not know what is wrong that I am still getting the

ERROR: Invalid char while reading mr.41.15.15.0.02.1.fa

Just to get this out of the way: are you using "~" instead of "/home/username/" in your full path ? Sometimes "~" is not correctly interpreted.

Also, try to read the file with "cat -v mr.41.15.15.0.02.1.fa", and check if any "^M" characters appear (these are windows new line).

As others has mentioned, you should check for anything other than ATCG in the sequence. For example, I noticed fasta output from canu-correct software has a "$" at the end of some sequences that will generate the error you mentioned.

Hi,

i had same issue,

in my case missing \n in TATTTTTAAGTATTTT[HERE]>contig_10.1_11288 on my file mr.41.15.17.0.029.1.fa

then, i fix replacing all > with \n> and remove blank lines:

cp mr.41.15.17.0.029.1.fa mr.41.15.17.0.029.1.fa.old

sed 's/>/\n>/' mr.41.15.17.0.029.1.fa.old | grep -vP "^$" > mr.41.15.17.0.029.1.fa

now ./assemble.sh

then

Running assembly with Flye ... _

works for me!!!

0 answers

No answers yet.

Log in to answer this question.