This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Probe Sequence Missing from Agilent Data

Hi,

I am analyzing raw microarray data obtained using the Agilent system. While looking at the results table, I found that a lot of the probes do not have a probe sequence. Could someone please guide me through these probes? Are these used only by the system, and do not mean anything biologically?

Thank you.

microarray agilent

Please provide some of these probe IDs. Also, 'probe sequences' do not normally appear in results tables. Can you clarify what you mean by 'probe sequence'?

Dear Kevin,

Thank you for your response. I am arranging some of the details below -

ProbeUID     ProbeName     Sequence

51568     GT_Mm_44k_51_P314501     ACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCA

1164     (+)E1A_r60_1     Sequence Column is Empty

And you said that probe sequences do not appear in the results table; I shall clarify that I used the script mentioned here previously enter link description here, and modified it according to my need.

E1A_r60_1 is an Agilent positive control probe. You should remove this and the other control probes from your dataset after you have normalised the data.

Thanks Kevin, for the clarification. Although, I would like to know why I should remove these after normalization, and what is the significance of these positive control probes?

The positive control probes are used during normalisation. In any experiment, the level of binding of these probes is expected to be consistent in each sample. They are akin to, for example, targeting GAPDH in PCR experiments.

You will find a lot more material online about both these and negative controls.

Why would you need these in your dataset when you proceed to differential expression analysis?

0 answers

No answers yet.

Log in to answer this question.