This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error in MUSCLE

Trying to run muscle on a file to build a tree. I successfully used muscle to align this file in .clw format yesterday. Now I tried running these two lines of code and received the same error each time. Anyone know what the error means and how to fix it?

 muscle -maketree -in seqs.afa -out seqs.phy

And I tried this:

  muscle -maketree -in seqs.afa -out seqs.phy -cluster neighborjoining

Error:

Internal error MSA::ExpandCache, ColCount change

I ran this code with success (output .afa and .phy):

   muscle -in seqs.fa -out seqs.afa -tree1 first.phy -maxiters 1

But it's not the type of tree that I want.

Here's my file to be built into a tree: https://drive.google.com/open?id=1QXXSJ2DJjJHz8K1WHuERFPQBTSvsWrcL

muscle debian-stretch phylogenetic fasta
• 3,969 views • link
updated by h.mon h.mon • written by mac03pat • mac03pat

Not affecting this issue but keep in mind that your input file: extracted_KS_with_taxa.fa, is with carriage return ^M.

• 0 views • link
written by AK AK

1 answer

Trying to run muscle on a file to build a tree. I successfully used muscle to align this file in .clw format yesterday.

Please be precise when asking a question. As input, MUSCLE accepts fasta files, and as you said your file is in clustal format, initially I believed this would be the cause of the error. You say your file is in clustal format, but it is in fasta format:

>DQ660910.3 Xanthoria elegans strain gbM10 polyketide synthase type I (PKSI) mRNA, complete cds [2526:3816](+)
ATCGCTATCGTGGGAATGGCGGGAAGGTTTCCGAATGCTGCCAATCACGAGTTGTTCTGGGA
>HM180409.1 Peltigera membranacea non-reducing type I polyketide synthase (PKS6) gene, complete cds join{[1258:1268](+), [1286:1342](+), [1402:1756](+), [1812:2658](+)}
GGAATGGCTGCCGACCATTCGAAATTCTGGGATTTACTTGAGTCGGGCTTAGACGTTCATAGAAAAATCCCGAAAGATCGGTTTGACGCA

The problem is muscle -maketree expects an aligned fasta as input, with all sequences having the same length (and, if needed, dashes indicating gaps), and your input is an unaligned multi-fasta file. You need first to align the sequences.

MUSCLE builds a "quick and dirty" tree using neighbour-joining. If your intention is to build a plylogenetic tree, I suggest you use something like PHYML, RAxML or IQ-Tree.

• 0 views • link
written by h.mon h.mon

Log in to answer this question.

More posts like this