This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to save nested for loop data in R

Hi, I am trying to extract few sequnces from a csv file. I am unable to save the result. The for loop is working once.

fasta <- read.csv("trial_seq.csv", header = TRUE, sep =",")
fasta
a<- as.character(fasta$Seq)
a   ###original file 
b = matrix(nrow=6, ncol=10)

for (i in 1:length(a)){
  for ( j in 1:nchar(a[i])) ######Succesfully extract 2-6 nt from start postion
  {
    b[j] <- substr(a, (j-(j-1)), j+1)
    ifelse ((j<=5),{print(b[j])}, break())
  }
  }
b
#####################File stored in "a"
[1] "ACGTATTGATGCCACAGACGTATTGATGCCACAGACGTATTGATGCCACAG"    
[2] "ACGTATTGATGCCACAGACGTATTGATGCCACAGACGTATTGATGCCACCC"    
[3] "ACGTATTGATGCCACAGACGTATTGATGCCACAGACGTATTGATGCCACTT"

Any help is much appreciated.

Thanks

r

Can you give a representative example of the input (ok you did that already) and the expected output. I am 99.99% sure this can be done with a simply one-liner avoiding any loop and if statements.

0 answers

No answers yet.

Log in to answer this question.