This is a test version of Biostars. For the public version, visit https://www.biostars.org.
find pattern in vi

I need to find patterns in the following sequence: GGAGTTCTACCGCAGGGGCGGGGAACTCCAAGTGATATCCATCATCGCATCCAGTGCGTCCGGTTTATCC TCGCTGACGCGGGGAACTCTTGGTTGTTCGGCGTTTTGAAGAGAACAAAAACGGTTTATCCCCGCTGGCG CGGGGAACTCGACTCAATGGCAACCGTCACGGCCTGTCCTGGCGGTTTATCCCCGCTGGCGCGGGAAC CGCGGTCGATTTTGCTGGCGTTGTTTCGGCTGGCGGTTTATCCCCGCTGGCGCGGGGAACTCTGCATAAA

I have this line :%s/ATG(.{3}){- 1.}(TAA|TAG|TGA)//g but it is incorrect.

sequence
• 467 views • link
written by rockfrancis • rockfrancis

Hello rockfrancis!

We believe that this post does not fit the main topic of this site.

This is not a bioinformatics question but a purely linux/vi one. We suggest seeking help at more appropriate forums (stackoverflow?)

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link
written by lieven.sterck lieven.sterck

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Pattern match using R Biostrings
    written by asumani asumani
    Hi, Aim: I am trying to get the positions of all stop codons and type of the stop codon given a DNAstring object or a …
  • Finding longest CDS for the sequence
    written by Sasha • Sasha
    Can someone please check/explain if my way of finding the **longest CDS**(potential coding sequence) is correct import re regex = r"(?:ATG|atg)\w+(?:TAG|TGA|TAA|tag|tga|taa)" test_str = "ttgcgttaaggtagatgatttttgtattttatattttggggagcaagaggacatggtatacagactcgtcatgttgctaatttcgccatcggcacacgggatgcagtcgaagcagcagaccggctctccctgtcggatccctttcctggtgccaggcttgcaattctcactgcacactgaccgaggtggctgaaaagcacagatgcagttgcatgacatttcctggcctaaaaattgaaaagaagtaaattatgaacagtgtgcaactgacctctaatgcttcattgttccagacaatggaatcattcttaatagtcatcctctcctctggggccaaggaagcattgtattgccccacggtcacatataatattcccccgttactgtcgagtccccaattgatgatgtcgtaatatccctccacatctctgccgtcaaagtagacctcctcatctgtgtgtggcactttgaagcgcacattcttcaagtagtacataagctataaacaaatgtcagatttcaatcaaacacgcacaagtggccacctctctcaaacgcaaacatggcaaagcgaaaaaatggattggagagaaagaacaataccagttatctgtcaagtttggcccgtataagggattgattggacaacacagagaaagtcacgtacctgccacggctcaaacttggtgatatcagcacagccgatcccaatgaatggcccgtgtcccggctcgcagtgctccagattgtgcagagcatgggcaacggcatacaccgctttgtatacgctgtggcaagacattgcagcctaccatgacaactccataataataataataggacgacaatggacaaaacctacatttgataggggactggataatgactcaagaagctagagtgtgaagtcacctgtaggtgattcgaagctgagaaatgtcagagtaggtgttgttgagctgagctaatgactcgctgccagta" matches …
  • orf finder
    written by e5cf5013 • e5cf5013
    How can I find which frame is producing the final protein? Is there any way to set all the frames? import re filename = input('Enter …
  • DNA to peptide translation and adding to csv file
    written by Sara Sara
    I have a big csv file with DNA sequences like this small example (infile.csv): 2840,GTGGCCCGGGAGGCC 291,GCATGTCCGTAGGTTCGT 147,GCATGTCCG I need to translate each DNA sequence to …
  • How to feed the sequence dictionary created with multifasta file into python function
    written by kousi31 • kousi31
    I am learning python through tutorials. I created a dictionary for multi-fasta file using the following code as explained in a lecture. I couldn't find …
  • Take out the GENES from DNA sequence while using FRMAES.
    written by abdullahqamer92 • abdullahqamer92
    I want to make a Python Program in which a DNA sequence is given in a text file. It has more than 9000 characters. I …
  • seperate partial cds from complete cds
    written by Bulbul Ahmed • Bulbul Ahmed
    I used the below perl script to remove out the partial cds, but its not working correctly and i am getting a blank output file. …
  • Why are UTRs ommitted in yeast sequence databases?
    written by Bharat Iyengar Bharat Iyengar
    There have been many studies reporting and annotating UTRs in *S. cerevisiae*. However, the standard databases such as SGD and ENSEMBL do not provide the …
  • Getting in frame stop codons from fasta
    written by User000 User000
    Hello, I need to find a start codon and all in frame stop codons related to that primary start codon, i.e startCodon_AGGAAG_stopCodon(1)_GAAGGTAACAGCTCTG_stopCodon(2)_ATCAAGA. This is my …
  • Python script to find ORFs not returning expected results for final frame
    written by njmcdonald • njmcdonald
    I am using this as a learning exercise, I realize there are existing tools to determine the end result. The goal is to gain experience …