This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Extracting Ancestral allele from INFO column of vcf file

Hi From my vcf file, I need to generate a text file with the following headers (shown just an example):
CHROM POS ID REF ALT AA
1 886817 rs11174805 C G C
1 886817 rs111111111 C T .
1 886817 rs11144444 A T A

Here AA column is the Ancestral allele column that can be obtained from the INFO column of the vcf file which has "AA=allele_name". In second row, "." implies missing "AA=." in INFO column and thus the ancestral allele is unknown. i have extracted the columns from my vcf file using: awk 'BEGIN {OFS ="\t" ; FS = "\t"};{print $1, $2, $3, $4, $5, $8}' chr22.vcf

This gives me columns - CHROM, POS, ID, REF, ALT, INFO.
INFO column looks like this: GAC=1;AF=0.000199681;AN=5008;NS=2504;DP=8012;EAS_AF=0;AMR_AF=0;AFR_AF=0;EUR_AF=0;SAS_AF=0.001;AA=.|||;VT=SNP

Now, using shell script, how can I extract AA from INFO and create a new column with AA alleles in it ?

Thanks

vcf snp ancestral allele shell linux
• 3,637 views • link
written by NS • NS

2 answers

Assuming that AA is defined in your header, like this:

##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele. Format: AA|REF|ALT|IndelType. AA: Ancestral allele, REF:Reference Allele, ALT:Alternate Allele, IndelType:Type of Indel (REF, ALT and IndelType are only defined for indels)">

Then, you can just do this:

bcftools query --format '%CHROM\t%POS\t%ID\t%REF\t%ALT\t%AA\n' 1000Genomes.Norm.bcf | head -20
1   10177   rs367896724 A   AC  |||unknown(NO_COVERAGE)
1   10235   rs540431307 T   TA  |||unknown(NO_COVERAGE)
1   10352   rs555500075 T   TA  |||unknown(NO_COVERAGE)
1   10505   rs548419688 A   T   .|||
1   10506   rs568405545 C   G   .|||
1   10511   rs534229142 G   A   .|||
1   10539   rs537182016 C   A   .|||
1   10542   rs572818783 C   T   .|||
1   10579   rs538322974 C   A   .|||
1   10616   rs376342519 CCGCCGTTGCAAAGGCGCGCCG  C   .
1   10642   rs558604819 G   A   .|||
1   11008   rs575272151 C   G   .|||
1   11012   rs544419019 C   G   .|||
1   11063   rs561109771 T   G   .|||
1   13011   rs574746232 T   G   t|||
1   13110   rs540538026 G   A   g|||
1   13116   rs62635286  T   G   t|||
1   13118   rs200579949 A   G   a|||
1   13156   rs552314247 G   C   g|||
1   13259   rs562993331 G   A   g|||
• 0 views • link
written by Kevin Blighe Kevin Blighe

Thanks for your help ! Is there also a way to keep only bi-allelic SNPs in this output using bcf tools ?

• 0 views • link
written by NS • NS

In addition to Kevin's answer, GATK has a very nice VariantsToTable tool for extracting data like this that is sometimes easier and quicker when your queries are more complicated.

• 0 views • link
written by jared.andrews07 jared.andrews07

Log in to answer this question.

More posts like this