How do I combine aligned reads from a clustal pipeline?

I am new to the field so I apologize if there is an easy solution. I have a bash/python pipeline set up that is aligning fasta files with a consensus sequence using clustal. These four files do not represent the entire sequence, they have gaps, and they overlap. My output file looks something like this but on a larger scale:

>Consensus
AAGGTCAAATCTCGTAGAAGCCCCCCGAGGCGAGGAGAAAAAAAACGAAGGTCCGTCGAG
TAAGACTCTCCTCCCTGAGGCTGGGATCCCGGCGGCCGGCGCCGCGACGCTGTTCGGCAG
CCATGGACTCCGGGACAGGAAGCTCCGCTGATCATATTCGTGACGCGTCTCTACCTGGTT

>Breed1A
- - - GTCAAATCTCGTAGAAGCCCCCCGAGGCGAGGAGAAAAAAAACGAAGGTCCGTCGAG 
- - - - - - - - - - - - - - - 

>Breed2A
- - - - - - - - - - - - - - - - - - - -CCCCGAGGCGAGGAGAAAAAAAACGAAGGTCCGTCGAG
TAAGACTCTCCTCCCTGAGGC - - - - - - - - - 

>Breed3A
- - - - - - - - - - - - - - - - - - - - - - - -GAGGCGAGGAGAAAAAAAACGAAGGTCCGTCGAG
TAAGACTCTCCTCCCTGAGGCTGGGATCCCGGC - - - - - -

>Breed4A
- - - - - - - - - - - - - - - - - - - - - - - -GAGGCGAGGAGAAAAAAAACGAAGGTCCGTCGAG
TAAGACTCTCCTCCCTGAGGCTGGGATCC - - - -

I have several different breeds, and it is taking too long copying a pasting to get a single sequence for one breed. Is there any tools or suggestions for how to tackle this problem?

Thanks

alignment sequence

• 1,038 views • link

updated 7.3 years ago by Ram

• written 7.3 years ago by crs68219 •

Please use the formatting bar (especially the code option) to present your post better. You can use backticks for inline code (`text` becomes text), or select a chunk of text and use the highlighted button to format it as a code block. I've done it for you this time.
code_formatting

• 0 views • link

written 7.3 years ago by Ram

Perhaps try the consensus tool from the EMBOSS package.

• 0 views • link

written 7.3 years ago by lieven.sterck

0 answers

No answers yet.