This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Selecting the correct docking position in miRNAs

Asking on behalf of a colleague who is trying to dock a drug to miR-155..

Only positions 12 and 24 are different from murine miR. Should these two positions be targeted?

>mmu-mir-155
uuaaugcuaauugugauaggggu
>hsa-miR-155-5p
uuaaugcuaaucgugauagggguu
rna-seq mirna docking

0 answers

No answers yet.

Log in to answer this question.