Hi All, I got stuck with the results after the mirdeep2 analysis. I have an independent microRNA analysis for 3 biological replicates in two treatments. After combining all data I often get results: 1. the same micro sequence, and pre-miRNA coordinates differ by one or several nucleotides 2. the same micro-sequence and the completely different pre-miRNA location How to deal with such cases during DE analysis? Which cases can I combine?
consensus mature sequence consensus star sequence precursor coordinate
___________________________________________________________________________________
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuu chr7:10801998..10802090:+
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuuu chr7:10801998..10802091:+
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuuug chr7:10801998..10802092:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuugu chr7:10801998..10802093:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuuguaa chr7:10801998..10802095:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuuguaaa chr7:10801998..10802096:+
Best regards,* Magda
•
written
by
klimek.magda •
1 answer
The phenomenon you are observing - particularly (1.) - is the presence of miRNA isoforms, or isomiRs. The simplest approach is to sum all isomiRs and then perform differential expression analysis. However, isomiRs may have biological importance, and it may be worth to perform the analysis at the isomiR level. For a short review and suggestion of analysis approach, see A Comprehensive Approach to Sequence-oriented IsomiR annotation (CASMIR): demonstration with IsomiR profiling in colorectal neoplasia.
Log in to answer this question.