hello everyone,
I identified some lincRNA from different light treatment and tissue specific data.Now I want to see differential expression of these lincRNA among these tissue and light specific data so for that I align individual raw read (tissue and light specific) to these lincRNA(predicted) then try to generate count file by featureCount but gave only zero while in samtools idxstats gave mapped reads. lincRNA file looks like:
>SL3.0ch00:1230877-1231088
GCCTATATATAGAGTACTAAATTCCTTAAAAAGGCATCTCGGAAGTTCCATAAATAGATCAAGATATCGAATAAGAGAGGTCAAATGTAAATCATCCTAGTTCGAGAAATACGCCACTAACGACCCTCGAATCATACAAAATCATGGAGAGTAGAATTAAGGGATCAATAGAATTGTACCGCTG
>SL3.0ch00:1147815-1150318
GAGCAGCCATAGAACAAAAGCAGTTGTGGGTGAGCTGGTTTAAACCTCCTCAATAAGAGGCGTGCGCACCAACAAGCGAGGGTTTGAATCCCACCAGTAGCATTTATTTTTTTAAAAAAATT
samtools idxstats accepted_hits.sort.bam > samid.txt
which looks like:
SL3.0ch00:1230877-1231088 211 0 0
SL3.0ch00:1147815-1150318 2503 0 0
SL3.0ch00:1147485-1147759 274 0 0
SL3.0ch00:1150608-1151254 646 4 0
because these lincRNA are from intergenic region so would overlap with original gtf file (which available at solgenomic website) so from these lincRNA file itself I created GTF file which looks like this:
SL3.0ch00 myIntergenic intergenic 1230877 1231088 . + . gene_id "xxx"; trancript_id "SL3.0ch00:1230877-1231088";
SL3.0ch00 myIntergenic intergenic 1147815 1150318 . + . gene_id "xxx"; trancript_id "SL3.0ch00:1147815-1150318";
featureCounts -T 60 -F GTF -t intergenic -a intergenic_created.gtf -o feature4.bed SLY_veg06_sorted.bam
this I used for feature Count but I got zero count for all transcript. kindly guide me how to solve this.
•
written
by
BioBaby •
Your chromosome names in your alignment are named SL3.0ch00:1230877-1231088 , your chromosomes names in the gtf are SL3.0ch00 . The gtf describes coordinates on the genome, the index you is in aligning against are the transcriptome coordinates.
Since the names are not equal featureCounts (and any other gene read assigner) will provide 0 reads. You can use the first two columns of your idxstat as a start to generate the gtf manually.
As above I showed GTF that is manually created from idxstat file only sir still it did not give.... I changed my database also:
>SL3.0ch00
GCCTATATATAGAGTACTAAATTCCTTAAAAAGGCATCTCGGAAGTTCCATAAATAGATCAAGATATCGAATAATATACAAATTGAT
>SL3.0ch00
GGATTATTCATAGAGAGAGGTCAAATGTAAATCATCCTAGTTCGAGAAATACG
even I paste SL3.0ch00:1230877-1231088 in first column of gtf to get match (I know its not valid) but this also didnot work. all combination I tried.
Although this would include multimapper in the counting.
But then your coordinates in the gtf are not 1230877 to 1231088 , but rather 1 to 211 .
Log in to answer this question.
Your
samtools idxstatsoutput shows no reads on the two lincRNAs from your custom GTF file.yes...but what about
??
??? Sorry but can you use real examples in your question, please? It is very hard to follow now
sorry for not clear but they are real examples only.
If you want good help, ask a clear question with good examples. That is my advice. Now it is misleading, if you gave clear examples from the beginning I wouldn't have commented.