pbalign does not produce output
Hi,
During run pbalign, I see that pbalign does not produce output. I tried different options — print to stdout, to file, by tmp files and that only creates empty file. It seems that pbalign (0.3.2) does not align my files. I also tried to run blasr and there is the same problem.
The command is:
pbalign 1529-13.subreads.bam ../Canu/1529-13/1529-13.contigs.fasta ../pbalign/1529-13/1529-13.aligned.bam
Head of 1529-13.subreads.bam is (after converting to sam):
m171229_125441_42242_c101415532550000001823309602281896_s1_p0/133/0_4918 4 * 0 255 * * 0 0
CGAGAGAGACACGCGCGGGTGGCGGGAATGGGCGTAAAACTACTGCTATGTAGTGAGCTTGTAGCGATTCAATTTCTGGTGCCCACAGAGAACAGTCCTGCCATGAAAAACCCGTCGCACGCTAAAATCATCACCTGGTGACCAGTTCCGCATTGAAAGCGGAAGATAGACGTTGGAAGACAAATAGAATAAAAATGACATATGGGCTGTGCTTAGGGCAAACACAAGGGAGGAAAACCGAAAGTTATGCAAAGCAAAGATTGCCTTAGACAATCAGCACATTGCATTA
head of ../Canu/1529-13/1529-13.contigs.fasta:
>tig00000001 len=4788647 reads=8296 covStat=6586.98 gappedBases=no class=contig suggestRepeat=no suggestCircular=yes
AAACCCGCGCGGCTTCTCGCTCAGATGTAATGGTGCGCTGATACCAACATAGGCTGCTTCCTGACTAAAAATAAACGTCTCCTGAATATGTGCAGCACAA
GTCCGGAAAAGGTAAAAGCAGCGGGCAAGTTTGTGCAAAAATCATGCAAAAAAGGAGAGCCTGTCGCTCTCCTGATTTTTAGTACTCCGAGTTGACAATG
ATTTCCTCGCCAAACGCGCCTGCCTGCGGCAGCGGTTTGTAAGTGGAGTTAGCGGCGCGCAGGATGCGAATACCG
• 1,853 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Please paste the exact commands you used, as well as the first few lines of your input file.
The command is:
Head of
1529-13.subreads.bamis (after converting to sam):head of
../Canu/1529-13/1529-13.contigs.fasta:Please edit your question and add this in there. Once that's done, you can delete your comment. This is so people would not need to read through sub-conversations to understand the premise of the top-level post.
Do you able to fix this issue?