Biostar Beta. Not for public use.
pbalign does not produce output
0
Entering edit mode
23 months ago
bwczech • 70
@bwczech37166

Hi,

During run pbalign, I see that pbalign does not produce output. I tried different options — print to stdout, to file, by tmp files and that only creates empty file. It seems that pbalign (0.3.2) does not align my files. I also tried to run blasr and there is the same problem.

The command is:

pbalign 1529-13.subreads.bam ../Canu/1529-13/1529-13.contigs.fasta ../pbalign/1529-13/1529-13.aligned.bam

Head of 1529-13.subreads.bam is (after converting to sam):

m171229_125441_42242_c101415532550000001823309602281896_s1_p0/133/0_4918        4       *       0       255     *       *       0       0
       CGAGAGAGACACGCGCGGGTGGCGGGAATGGGCGTAAAACTACTGCTATGTAGTGAGCTTGTAGCGATTCAATTTCTGGTGCCCACAGAGAACAGTCCTGCCATGAAAAACCCGTCGCACGCTAAAATCATCACCTGGTGACCAGTTCCGCATTGAAAGCGGAAGATAGACGTTGGAAGACAAATAGAATAAAAATGACATATGGGCTGTGCTTAGGGCAAACACAAGGGAGGAAAACCGAAAGTTATGCAAAGCAAAGATTGCCTTAGACAATCAGCACATTGCATTA

head of ../Canu/1529-13/1529-13.contigs.fasta:

>tig00000001 len=4788647 reads=8296 covStat=6586.98 gappedBases=no class=contig suggestRepeat=no suggestCircular=yes   
 AAACCCGCGCGGCTTCTCGCTCAGATGTAATGGTGCGCTGATACCAACATAGGCTGCTTCCTGACTAAAAATAAACGTCTCCTGAATATGTGCAGCACAA
GTCCGGAAAAGGTAAAAGCAGCGGGCAAGTTTGTGCAAAAATCATGCAAAAAAGGAGAGCCTGTCGCTCTCCTGATTTTTAGTACTCCGAGTTGACAATG
ATTTCCTCGCCAAACGCGCCTGCCTGCGGCAGCGGTTTGTAAGTGGAGTTAGCGGCGCGCAGGATGCGAATACCG
pbalign • 163 views
ADD COMMENTlink
0
Entering edit mode

Please paste the exact commands you used, as well as the first few lines of your input file.

ADD REPLYlink
0
Entering edit mode

The command is:

pbalign 1529-13.subreads.bam ../Canu/1529-13/1529-13.contigs.fasta ../pbalign/1529-13/1529-13.aligned.bam

Head of 1529-13.subreads.bam is (after converting to sam):

m171229_125441_42242_c101415532550000001823309602281896_s1_p0/133/0_4918        4       *       0       255     *       *       0       0
       CGAGAGAGACACGCGCGGGTGGCGGGAATGGGCGTAAAACTACTGCTATGTAGTGAGCTTGTAGCGATTCAATTTCTGGTGCCCACAGAGAACAGTCCTGCCATGAAAAACCCGTCGCACGCTAAAATCATCACCTGGTGACCAGTTCCGCATTGAAAGCGGAAGATAGACGTTGGAAGACAAATAGAATAAAAATGACATATGGGCTGTGCTTAGGGCAAACACAAGGGAGGAAAACCGAAAGTTATGCAAAGCAAAGATTGCCTTAGACAATCAGCACATTGCATTA

head of ../Canu/1529-13/1529-13.contigs.fasta:

>tig00000001 len=4788647 reads=8296 covStat=6586.98 gappedBases=no class=contig suggestRepeat=no suggestCircular=yes   
 AAACCCGCGCGGCTTCTCGCTCAGATGTAATGGTGCGCTGATACCAACATAGGCTGCTTCCTGACTAAAAATAAACGTCTCCTGAATATGTGCAGCACAA
GTCCGGAAAAGGTAAAAGCAGCGGGCAAGTTTGTGCAAAAATCATGCAAAAAAGGAGAGCCTGTCGCTCTCCTGATTTTTAGTACTCCGAGTTGACAATG
ATTTCCTCGCCAAACGCGCCTGCCTGCGGCAGCGGTTTGTAAGTGGAGTTAGCGGCGCGCAGGATGCGAATACCG
ADD REPLYlink
0
Entering edit mode

Please edit your question and add this in there. Once that's done, you can delete your comment. This is so people would not need to read through sub-conversations to understand the premise of the top-level post.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.3