Hello! I used mugsy to align the three whole genome sequence.it work fine and give me output in .maf form.
In output file some blocks are like this,and these are okay because i used three sequences to align
a score=994 label=943 mult=3
s GCA_000009805.AP006618.1 2786668 988 + 6021225 AGGAGGCATCGATGA-CACT-CGCA
s GCA_000250675.CP003876.1 2232832 1730 + 9436348 AAGCGTTGATCAGCAGGTTACGCA
s GCA_000523235.CP006850.1 55416 985 - 8348532 AGGAGACATCGATGACGCTGTC-CA
But some blocks are lie this, means only two sequences in a block while i run the three sequences
a score=992 label=946 mult=2
s GCA_000009805.AP006620.1 62811 985 + 87093 TCAGGCCAGGGTGAGGACC--T
s GCA_000523235.CP006850.1 5238627 974 + 8348532 TCAGGCCAGGGCGAGAAACAAT
Do anybody know, why some blocks has only two seq?
0 answers
No answers yet.
Log in to answer this question.