That's it! Thanks!!
I need to do permutation to 10,000 DNA sequences, the length of which are between 200bp~1000bp. In fact, for each sequence, I only need 5,000 permutations to do Monte-Carlo simulation. However, when perl modules List::Permutor or Algorithm::Permute was applied, I found 5,000 permutations of one sequence were quite similar, which went against my intention of random sampling. And to generate a universal set of permutation then randomly sampling is too time consuming. So my question is: is there a way to do a random permutation?
In fact, all I need to do is to search the enriched motif (5mer-10mer) on the sequence sets. So if there is any program for this, plz tell me :)
Thank you!
4 answers
How about the EMBOSS program, shuffleseq?
Description: This takes a sequence as input and outputs one or more sequences whose order has been randomly shuffled. No bases or residues are changed, only their order.
You can run it something like:
shuffleseq -sequence myseqs.fa -outseq myshuffledseqs.fa -shuffle 5000
You're welcome. An "accept answer" is always appreciated :-)
The tools that you tried are designed to give you all permutations without repeating the same sequence, so they will go methodically one by one, if all you want are a few random shuffles you can easily generate them directly in most programming languages, a Python solution would look like so:
import random
seq = list("ATAAAAGGATCCCCAC")
for step in range(10):
random.shuffle(seq)
print ''.join(seq)
---------- Python ----------
CTAAACCGCATAGACA
CCAACTAAGATGACCA
GACCACTCGTCAAAAA
ACAAAGCTATAGACCC
CAAGGATCCACCATAA
ACATCAAGACAATCGC
AGCTCGCCAACTAAAA
CAATGCCAACACATAG
TCAAAGAACCGATCCA
ATAGCCCACAAAACTG
Theoretically this could generate duplicate sequences but if your sequences are long the chance for that to happen is very low.
Thanks!! Do you know the corresponding function of random.shuffle in perl?
Its perhaps not exactly what you want, I'm not very clear, but SeqGen might be useful. It is particularly good if you want not entirely random changes but rather changes constrained within a biologically realistic model of mutation.
"Seq-Gen is a program that will simulate the evolution of nucleotide or amino acid sequences along a phylogeny, using common models of the substitution process. A range of models of molecular evolution are implemented including the general reversible model. State frequencies and other parameters of the model may be given and site-specific rate heterogeneity may also be incorporated in a number of ways. Any number of trees may be read in and the program will produce any number of data sets for each tree. Thus large sets of replicate simulations can be easily created. It has been designed to be a general purpose simulator that incorporates most of the commonly used (and computationally tractable) models of molecular sequence evolution."
Thanks to all the answers! I've just found a way for perl coders: the Algorithm::Numerical::Shuffle module.
e.g.
use Algorithm::Numerical::Shuffle qw /shuffle/;
my $seq = "CGATCGATCGATCGATCGTAGCTAGCTAGCT";
my $shuf = shuffle [split(//, $seq)];
for my $i (1..5000) {
my @shuffled_seq = shuffle $shuf;
}
Log in to answer this question.
what do you mean by permutation? Do you have to generate random sequences? random sequences from the same set of bases? do you need to change the order of a set of sequences you have? The question would be clearer with an example.
Yes, permutation means changing the order of original sequence. Say, if I have a sequence: CAGCTAGCATCGATCGTA
I want to change the order randomly 5000 times. However, when I applied the permutation modules, it generated:
CAGCTAGCATCGATCGAT CAGCTAGCATCGATCAGT CAGCTAGCATCGATACGT ...
So for a long sequence (e.g. 500bp), 5000 times of permutations are quite similar, which cannot be a Monte-Carlo simulation; If I take all the possibilities, it needs horrible time.