This is a test version of Biostars. For the public version, visit https://www.biostars.org.
standalone blast output to excel

I want the standalone blast output in a specific format, which needs to have only aligned sequence the corresponding sequence id . Hence, is it possible to dump standalone blast output to excel?

alignment genome sequence
• 3,412 views • link
written by shuksi1984 • shuksi1984

which needs to have only aligned sequence the corresponding sequence id.

Could you please explain more ?

• 1 views • link
written by Chirag Parsania Chirag Parsania

Following should be the content of excel:

Score   Expect  Identities  Gaps    Strand
6.684e+06 bits(3619559)     0.0     3619559/3619559(100%)   0/3619559(0%)   Plus/Plus

Query  1       
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct  1 
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
• 1 views • link
updated by finswimmer finswimmer • written by shuksi1984 • shuksi1984

you can indeed (as 5heikki says) get this from the tabular blast output. It might/will require some reformatting though as you will get all on a single line from blast

• 1 views • link
written by lieven.sterck lieven.sterck

Yes, just use -outfmt 6 or -outfmt 10 for tab or comma separated values and import to excel accordingly. You also need to define the output fields you're interested in. You can see all options with blastn -help

• 1 views • link
written by 5heikki 5heikki

0 answers

No answers yet.

Log in to answer this question.

More posts like this