Seem seqtk seq has no -F option:

• seqtk seq -F seq: invalid option -- 'F'

Usage: seqtk seq [options] <in.fq>|<in.fa>

Options: -q INT mask bases with quality lower than INT [0]

     -X INT    mask bases with quality higher than INT [255]
     -n CHAR   masked bases converted to CHAR; 0 for lowercase [0]
     -l INT    number of residues per line; 0 for 2^32-1 [0]
     -Q INT    quality shift: ASCII-INT gives base quality [33]
     -s INT    random seed (effective with -f) [11]
     -f FLOAT  sample FLOAT fraction of sequences [1]
     -M FILE   mask regions in BED or name list FILE [null]
     -L INT    drop sequences with length shorter than INT [0]
     -c        mask complement region (effective with -M)
     -r        reverse complement
     -A        force FASTA output (discard quality)
     -C        drop comments at the header lines
     -N        drop sequences containing ambiguous bases
     -1        output the 2n-1 reads only
     -2        output the 2n reads only
     -V        shift quality by '(-Q) - 33'
     -U        convert all bases to uppercases
     -S        strip of white spaces in sequences

I converted fastq file to fasta using the following command - seqtk seq -aQ64 sample1.fastq > sample1.fasta

but in output - i am getting other words besides A, T , G, C- for example - W & R

CACACWCAACCCAGGTATGCATGCACATGCACGTCCATCTGCACACTCAACCCAAGCATGTGCACACACRCACACTTGTACACACACACTCAACCCAAGCACATGTGCAGTT

Can anyone tell why I am getting this result and what is the interpretation of this type of result?