This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bowtie2 error: Read .... has more quality values than read characters.

Hello,

I was trying to map my reads as follow:

bowtie2 -x dbref -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq -S eq2.sam

However I got the following the errors: 

perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
        LANGUAGE = (unset),
        LC_ALL = (unset),
        LC_CTYPE = "UTF-8",
        LANG = "en_US.UTF-8"
    are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_US.UTF-8").
Error: Read D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC has more quality values than read characters.
Error: Encountered exception: 'Unidentified exception'
Command: /usr/bin/bowtie2-align-s --wrapper basic-0 -x dbref -S eq2.sam -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq 
(ERR): bowtie2-align exited with value 1

Any suggestion how I could solve this?

assembly bowtie2 error read
• 4,868 views • link
updated by Biostar Biostar • written by c.clarido c.clarido

What does grep -A 3 "D00476:230:C8TCRANXX:8:2214:1156:2230" /home/s1104230/output/tR1.fastq show? Looks like a malformed file.

• 1 views • link
written by Devon Ryan Devon Ryan 
@D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC
AAAAATTATTCTAATTCCACCGTGCGCATTGCTTTCTTATTTACAAGGAAAAAAGATCGAAATCGAAACAAAAAGTGTACCGCGATTTCTG
+
3>BBCGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFDGGGGGGGGGGGGGGEGGGGGGGGGGGGGGG<GGGFGGGGGGGGGGGGGGGGDGGGGFGGGGGGGGGGGCGGGEGGGGGGGGGGGGGGG
• 1 views • link
written by c.clarido c.clarido

1 answer

As you can see bowtie was right: more quality than nucleotide characters. As Devon suspected: malformed fastq file. How did you obtain this fastq?

• 1 views • link
written by WouterDeCoster WouterDeCoster

It was given paired-end reads and we were asked to trim it on our own using Cutadapt algorithm. Does that mean that I also need to trim the quality scores along with the sequence? (oops)

• 1 views • link
written by c.clarido c.clarido

Yes, make sure to use cutadapt rather than trying to implement it yourself.

• 1 views • link
written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this