Virsorter Output Incomplete
Does anyone already had an error such like mine?
VirSorter are generating outputs like this for some of my draft genomes:
>VIRSorter_AWYH01000028_1-cat_1
CTGTCGGAATATCTTCGCCCCGTCCAGAATGCCGCTTGCCGCGTCCGGAATAGTCATACATTTGATAGGTCAC...
With no information regarding the contig coordinates. The regular VirSorter is like the one bellow (without the missing information about sequence coordinates beginning [280241] and end [327316]):
>VIRSorter_AXBS02000010_1_gene_284_gene_343-280241-327316-cat_4
AACTTGCGGGAATAGTTTCCGCAACTTACAGACTATCCCCCGTTGGTGCTCACTTGGTAGGCTTCACTACTTCCCCAACGCGCCGA
I'm not sure if (the error mentioned) is somehow related to the different categories (in my first example, it's a phage in category 1 and in the second example it's a phage in category 4).
BTW, is there any BLAST script to find the coordinates of those sequences that any of you guys might know?
• 1,348 views
•
link
0 answers
No answers yet.
Log in to answer this question.