This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Virsorter Output Incomplete

Does anyone already had an error such like mine?

VirSorter are generating outputs like this for some of my draft genomes:

>VIRSorter_AWYH01000028_1-cat_1
CTGTCGGAATATCTTCGCCCCGTCCAGAATGCCGCTTGCCGCGTCCGGAATAGTCATACATTTGATAGGTCAC...

With no information regarding the contig coordinates. The regular VirSorter is like the one bellow (without the missing information about sequence coordinates beginning [280241] and end [327316]):

>VIRSorter_AXBS02000010_1_gene_284_gene_343-280241-327316-cat_4
AACTTGCGGGAATAGTTTCCGCAACTTACAGACTATCCCCCGTTGGTGCTCACTTGGTAGGCTTCACTACTTCCCCAACGCGCCGA

I'm not sure if (the error mentioned) is somehow related to the different categories (in my first example, it's a phage in category 1 and in the second example it's a phage in category 4).

BTW, is there any BLAST script to find the coordinates of those sequences that any of you guys might know?

virsorter
• 1,349 views • link
written by oseias.rf.junior • oseias.rf.junior

0 answers

No answers yet.

Log in to answer this question.

More posts like this