hisat2 / bowtie: read has more quality values than read characters

I'm struggling with this issue:

./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes/21dpi_T_R2.fq.gz,../../data/mrcv/genes/21dpi_T_R3.fq.gz,../../data/mrcv/genes/21dpi_T_R4.fq.gz -S ../../data/mrcv/genes/alignment/21.sam --un ../../data/mrcv/genes/alignment/21UN.sam -p 6 

Error: Read J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT has more quality values than read characters.
terminate called after throwing an instance of 'int'
Aborted (core dumped)
(ERR): hisat2-align exited with value 134

Scythe was used to remove adapter contamination and Sickle to remove low-quality reads.

I'm using HISAT2 version 2.1.0 on Ubuntu 18.04. Any ideas what could be wrong?

bowtie2 hisat2 hisat bowtie

• 9,350 views • link

written 7.9 years ago by juan.crescente •

Could you show the record (header, sequence and quality) J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT in your post please

• 1 views • link

written 7.9 years ago by Bastien Hervé

Cannot really comment on hisat2, but I had this problem with BWA mem sometimes, and it always was a memory problem. How much RAM do you have available? HISAT2 is actually not very memory-consuming, not sure if this is the problem. Also, agreed with Bastien, check if indeed SEQ and QUAL are different for J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT.

• 1 views • link

written 7.9 years ago by ATpoint

I have 32 GB of RAM.

The line seems fine:

@J00113:78:H3JKNBBXX:3:2209:5670:22819 1:N:0:ATCACG
CCATGATCTTAGTTTCTGGCGCTCGTTCGTCGCGAAATAAGCCGAGGTGT
+
<AFFFJJJJFJJJFJJJJJJJFFJFJFFJJJJ7<JAJFF<FJJJ<JJ7F<

Increasing swap would be a solution? Running each file separately instead of all at the same time seems to work until now, I'm still trying to figure out what to do next when alignments are separated. Im adding read group labels into each.

• 1 views • link

written 7.9 years ago by juan.crescente •

Are you pipe the output into a sorting tool that might take up some memory?

• 1 views • link

written 7.9 years ago by ATpoint

I don't. This is the command I'm using

 ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes/21dpi_T_R2.fq.gz,../../data/mrcv/genes/21dpi_T_R3.fq.gz,../../data/mrcv/genes/21dpi_T_R4.fq.gz -S ../../data/mrcv/genes/alignment/21.sam --un ../../data/mrcv/genes/alignment/21UN.sam

thanks for the help

• 1 views • link

written 7.9 years ago by juan.crescente •

It's not the good record, primers are different CGATGT ATCACG

• 1 views • link

written 7.9 years ago by Bastien Hervé

you're right!

@J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT
CTCGGAGCCACTCTTGGCCTCCCGGGAGCTGATGTAAGGCCCTTAGGGAA
+
AAFFFJJAJJJJJJJJGGCGTGTACCAGTTTGTAGACAAGTACGGTGCCAACGTCGACGGCTAC
+
AAFFFJJJJJJJJJJJJJ1TGT
TTCCCTTTJJJJJ1TGT
TTCCCTJJ

Indeed the record seem odd!

• 1 views • link

written 7.9 years ago by juan.crescente •

Thus, I let you investigate Scythe and Sickle log files to find out what happened

• 1 views • link

written 7.9 years ago by Bastien Hervé

1 answer

I could verify with

gzip -t R2.fq.gz && echo ok || echo bad

that the file was corrupted. For some reason the reads were not in the correct line. Re-downloading the file solved the issue.

• 1 views • link

written 7.9 years ago by juan.crescente •