This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to fetch GFF information for genome downloaded from ENA?

Hi,

We have done variant analysis using Oryza sativa Indica genome downloaded from the link below. https://www.ebi.ac.uk/ena/data/view/GCA_000004655.2 - (WGS_SET_FASTA)

Later for doing the annotation, we were not able to find a corresponding GFF file for the genome fasta.

Sample Genome fasta format is as below.

>ENA|AAAA02000004|AAAA02000004.1 Oryza sativa Indica Group cultivar 93-11 chromosome 1 Ctg000004, whole genome shotgun sequence.
GGGCGTTACGTCTTCACGACCGGCTTGCCTTCGCCGCTGCCACGGTGTTTCCGCCTGCAC
GGCTGGCCTTTATGCCGCCGTTGTTGGGCGTCTACGTCTTCACCGACCGGCTTGCCTTCG
CCGCTGCCGACTGCTGTTTCCGCCTGCACGGCTGGCCTTTATGCCGCCGTTGTTGGGCGT

We tried to download GFF from various other databases all are having different chromosome notations. Is there any way we can fetch GFF for this. Or if there is anyway to convert these "AAAA02000004.1" ids to fetch gene informations?

Thank you in advance.

Regards, Athul

genome snp annotation snpeff oryza

0 answers

No answers yet.

Log in to answer this question.