This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How can I Rectify Segmentation fault: 11?

Hello all. I am trying to map some fasta files I generated from a TE.bed file. But I get the segmentation fault:11 error. some suggest its a memory problem and for that reason I tried to avoid outputting unaligned reads but it didnt help either. below is my command.

bowtie genome.index -f TE.fasta --un unal.fa --al al.fa -S out.sam

I would appreciate your suggestions please. Thanks

mapping smrna bowtie

did you use the precompiled binary? In case you did there might be incompatibilities which lead to the segmentation fault. Potentially you missed something in the stacktrace pointing to some lower level dependency? In this case, give it a try and compile from source.

Is there a reason for choosing bowtie over bowtie2?

The fasta was generated as follows, bedtobam then bedtools getfasta to make fasta from bam. I dont understand what you mean by precompilled binary and compile from source. Also, I chose bowtie instead of bowtie2 because Im trying to map si and piRNA overlaps with a python script.

1 answer

For bowtie, -f and -S are boolean flags, they don't take any values. Try the following command:

bowtie -f -S --un unal.fa --al al.fa genome.index TE.fasta > out.sam

This still gave the Segmentation fault: 11 error

Then lets take a few steps back:

1) how did you install bowtie?

2) did you try running bowtie outside your python script, directly on the command-line?

3) could you post a few lines of your TE.fasta file?

  1. Bowtie was already on this machine but I recently tried to upgrade it with brew. it works with original fasta before now.
  2. Yes. Im currently running the bowtie on command line (terminal) and not with python. I was going to use the python later
  3. 3.

Example reads:

>Bf_V2_1:61669-61692
AAGAAAGAAAGAAAGAAAGAAAG
>Bf_V2_1:62125-62197
TTTAATTGCAAGTTCTTGCCCGAGGGCTAATTGCAACATGGGACATACAGAATACATAGTAAACATACATAA
>Bf_V2_1:62297-62447
TTGTGGTTTGATTTCTTTTCTGGAAGCAGTGGAAGACGAAATGTCCCACTTTTTCTATGATGAGTGGGTTATGCGATGTTAACAGGGCTACAGTTTTGTTTTCGTCAGTAAACAATTGGAAAAATTGTAACAAACATTCATAGCTTCTTC
>Bf_V2_1:63006-63027
AAAAAAAAATTAAAATAAATT

there are longer reads region.

Hi jaqx008,

I'm not sure whether you mean "it worked before you upgraded" or "it works now, after you upgraded"

it works with original fasta before now.

From your replies I assume the first case and hence suggest to revert back to the original executable, if possible.

Log in to answer this question.