Hey everyone, I am currently trying to use fastx_collapser of a fastq file and I am getting the error below. When I looked in the fastq file, there are numerous places with '/'. How do I correct this and collaps my fastq file? By the way, I have tried some of the recommendations with -Q33 and out put file wasnt a fastq file and dont know what to do with it. Thanks
fastx_collapser -v -i file.fastq -o 2file.fastq
fastx_collapser: Invalid quality score value (char '/' ord 47 quality value -17) on line 56
AAAAAEEEAEEAAEAEE/EAE/EEEEEAEEE/E/EE
@NS500519:44:HHHTLBGX2:1:11101:23901:1069 1:N:0:CAGATC
GTAACCTGTAGATCCGAATTTGTG
+
6A6/AE/AE6EE/EEEAA6EE/EE
@NS500519:44:HHHTLBGX2:1:11101:5260:1069 1:N:0:CAGATC
CATTGCACTCGTCCCGGCCTGA
3 answers
I suggest that you use clumpify.sh ( A: Introducing Clumpify: Create 30% Smaller, Faster Gzipped Fastq Files ) instead of fastx_collpaser.
Another suggestion:
Run Trimmomatic on your data with the TOPHRED33 flag, see whether that'll change your quality scores.
Log in to answer this question.
-
How do I carry out small RNA assembly?
written by jaqx008
/is a valid quality character for Phred+33.Is the fastq snippet you posted the very beginning of the file? Because it starts at a quality line, not at a header. Mind you, there is a previous post where the error has been exactly this: FASTX error - quality score
No its not the begining of the file. its somewhere after line 50 I think.
Ok let me try this suggestions.