This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Getting BAM files using Bowtie

Hi everyone,

I have a set of merged unpaired reads (RNA seq data) that are in ASCII text format (e.g. sample1_MERGED). I've used Megahit to co-assemble them and get the contig files. Now I wish to get the BAM files using Bowtie but I am not sure how it is done properly for unpaired reads like those I have. The unpaired reads are as below:

>demoneme_02_60847700|K00242:68:H7FKMBBXX:5:2201:28534:49247 1:N:0:GGCTAC|o:36|m/o:0.000000|MR:n=0;r1=0;r2=0|Q30:n/a|CO:0|mismatches:0
atggacgatatcttttacaaaaaaagtgtcttgcgtagaaatacaacttccggtgagaacaagacttgacaaaactccaaaattatttgtcgcttttttgactccctgaatttgaatagtaagatacccaattgggatattggtccattctcccacataaaatt
>demoneme_02_60847705|K00242:68:H7FKMBBXX:5:2201:31050:49247 1:N:0:GGCTAC|o:75|m/o:0.000000|MR:n=0;r1=0;r2=0|Q30:n/a|CO:0|mismatches:0
agaaggtagggatgacgtcaagtcatcatggcccttacgaccagggctacacacgtgctacaatggcgcatacaaagagaagcgacctcgcgagagcaagcggacctcataaagtgcgtcgtagt

Based on the manual, I tried to use the flag -U <my files=""> as the following:

bowtie2 -x 2 ../04_MAPPING/contigs -U sample1_MERGED --no-unal -S ../04_MAPPING/sample1.sam

Then I get this error: Error: reads file does not look like a FASTQ file

Which tells me that my files are not in fastq format.

And if I use --tab5 instead of -U as below:

bowtie2 --threads 2 -x ../04_MAPPING/contigs --tab5 sample1_MERGED --no-unal -S ../04_MAPPING/sample1.sam

Then I won't get an error but below message:

0 reads 0.00% overall alignment rate

Does Bowtie support single merged (unpaird) reads in txt formats as an input? Any help/advice would be much appreciated. Please let me know if my question is not clear enough.

Cheers

Navid

assembly bowtie software error rna-seq mapping

You don't have the original fastq reads to align against the contigs you made?

If fasta files is all you have you could use bbmap.sh from BBMap suite to do the alignment or create fake Q-score values (and thus convert the fasta files to fastq format, not the best option).

1 answer

You have to pass the -f parameter so bowtie2 know you have fasta files.

bowtie2 -f --threads 2 -x ../04_MAPPING/contigs -U sample1_MERGED --no-unal -S ../04_MAPPING/sample1.sam

Likewise, in the off chance you do have tab5 files, you don't use --tab5 file.tab5, it is --tab5 -U file.tab5.

Thanks a lot for the help. It seems to be working with adding the flag -f. My best N

NAVID.BAVI : If an answer was helpful, you should upvote it; if the answer resolved your question, you should mark it as accepted.
Upvote|Bookmark|Accept

Log in to answer this question.