This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Needing help with a Count table Graph

Hello Guys, This is not much of a computation question. I made this count table bar graphs for siRNA I have from RNAseq data of a female organism. overral, the siRNA was low for all BUT ONE loci. Im trying to identify the mRNA regulated by this one siRNA (ACCCATAGATCCGAGCTTGTG) but dont know how to go about this. Also, I am open to any suggestion as to what is happening at this one loci. siRNA image below

sirna counttable mapping loci id
• 1,334 views • link
written by jaqx008 jaqx008

Does your organism have a known transcriptome? If not, is there a decently well studied related organism? Worst case scenario you can just blast your sequence against a related transcriptome and see what it hits.

• 1 views • link
written by Devon Ryan Devon Ryan

Thanks. My organism (lancelet) does not have a well anotated genome. I did blast the 21nt sequence and got a protein that I assume should correspond to were the siRNA regulate. I used this protein to blast a related specie (Homo sapien or mouse). and got 

BCAT_beta_family    cd01557 
BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the ...
24-319  4.54e-126
PRK13357    PRK13357    
branched-chain amino acid aminotransferase; Provisional
1-330   8.69e-126
ilvE_II TIGR01123   
branched-chain amino acid aminotransferase, group II; Among the class IV aminotransferases are ...
12-326  8.31e-97
IlvE    COG0115 
Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid ...
11-321  7.47e-60
Aminotran_4 pfam01063   
Amino-transferase class IV; The D-amino acid transferases (D-AAT) are required by bacteria to ...

I wasnt sure I was doing the right thing.

• 1 views • link
written by jaqx008 jaqx008

0 answers

No answers yet.

Log in to answer this question.

More posts like this

No similar posts found.