This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Hisat2 build index error

Hello, I downloaded Saccharomyces reference genome from SGD, the latset version. And then I used hisat2-build to build index, code as :

hisat2-build --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX

But there is always this mistake:

Reference file does not seem to be a FASTA file
  Time to join reference sequences: 00:00:00
Total time for call to driver() for forward index: 00:00:01
Error: Encountered internal HISAT2 exception (#1)

Command: hisat2-build --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX Deleting "./INDEX.1.ht2" file written during aborted indexing attempt. Deleting "./INDEX.2.ht2" file written during aborted indexing attempt. Deleting "./INDEX.3.ht2" file written during aborted indexing attempt. Deleting "./INDEX.4.ht2" file written during aborted indexing attempt. Deleting "./INDEX.5.ht2" file written during aborted indexing attempt. Deleting "./INDEX.6.ht2" file written during aborted indexing attempt. Deleting "./INDEX.7.ht2" file written during aborted indexing attempt. Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

what should I do about it?

thanks for your answer.

rna-seq

Why are you adding the --wrapper (or if that is not your original command then please provide that instead)? A simple

hisat2-build -f S288C_reference_genome_R64-2-1_20150113.fa S288C

should be enough.

still the same error

What do the following two commands print?

head -4 S288C_reference_genome_R64-2-1_20150113.fa and grep ">" S288C_reference_genome_R64-2-1_20150113.fa?

Settings:

 Output files: "./INDEX.*.ht2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Local offset rate: 3 (one in 8)
  Local fTable chars: 6
  Local sequence length: 57344
  Local sequence overlap between two consecutive indexes: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  S288C_reference_genome_R64-2-1_20150113.fa
Reading reference sizes
Warning: Encountered reference sequence with only gaps
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Reference file does not seem to be a FASTA file
  Time to join reference sequences: 00:00:00
Total time for call to driver() for forward index: 00:00:01
Error: Encountered internal HISAT2 exception (#1)
Command: hisat2-build --wrapper basic-0 -f S288C_reference_genome_R64-2-1_20150113.fa ./INDEX
Deleting "./INDEX.1.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.2.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.3.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.4.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.5.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.6.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.7.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

This is NOT the output of the two commands I had asked you to provide output of.

There aren't the two commands print that you asked.

If the head and grep command are not printing any useful output then there is something wrong with your fasta format sequence file. What does file S288C_reference_genome_R64-2-1_20150113.fa show? If it does not show ASCII text you may have a corrupt sequence file, which you will need to re-download.

These are two commands outputs:

 S288C_reference_genome_R64-2-1_20150113/0000775000554500003120000000000012463257272016120 5ustar  shuaishuaiS288C_reference_genome_R64-2-1_20150113/rna_coding_R64-2-1_20150113.fasta0000664000554500003120000054452712455312025023155 0ustar  shuaishuai>HRA1 HRA1 SGDID:S000119380, Chr I from 99305-99868, Genome Release 64-2-1, ncRNA_gene, "Non-protein-coding RNA; substrate of RNase P, possibly involved in rRNA processing, specifically maturation of 20S precursor into the mature 18S rRNA"

GGGCCCTTTCT`enter code here`TCCGTTTGAACGTAAAGGCATTTTTGAGACCATTACCAAACCTAGCAAA
TAAACCGGGAGGCTTGACTGCTCGTAGGGATTGTGGTTGATATGCATCTGAGTCGAATCT
ATTGGCATTCCAAGACGTTTGGTCGTCATGGTTATTGCTCATAAATAGATTTTCATGGAC

Binary file S288C_reference_genome_R64-2-1_20150113.fa matches

Looks like your fasta sequence file is corrupt. You will need to re-download the file. It should be plain text in right format.

ok, thank you.

I re-download the reference genome several times. But still the same error.

wuwuwu....

Where and how are you downloading the reference from?

If that is not working then you could download pre-made indexes from iGenomes site. That includes sequence/annotation/indexes everything.

Command:

hisat2-build --wrapper basic-0 --wrapper basic-0 S288C_reference_genome_R64-2-1_20150113.fa ./INDEX
Deleting "./INDEX.1.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.2.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.3.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.4.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.5.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.6.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.7.ht2" file written during aborted indexing attempt.
Deleting "./INDEX.8.ht2" file written during aborted indexing attempt.

Please edit your original question or use ADD REPLY/ADD COMMENT when providing additional information. SUBMIT ANSWER should only be used for providing new answers for original question.

0 answers

No answers yet.

Log in to answer this question.