Hi my friends
Maybe my question is very simple, but, I'm not familiar with the programming language. I use the following script to extract sequence from fasta file. How can I write similar command to remove the sequences by sequence IDs from fasta file.
cut -c 2- ID.text | xargs -n 1 samtools faidx in.fasta > out.fasta
Thanks for your help
•
written
by
Janey •
2 answers
Hello Janey,
you could use seqkit for this task.
$ seqkit grep -v -n -f id_list.txt in.fasta > out.fasta
fin swimmer
Hello Janey,
please be more patient. We all doing this here in our free time. So don't expect to get a ready-to-use-solution within some minutes.
Which file do you downloaded from seqkit? What platform are you using (windows, linux distribution ...)? What are you meaning with "but did not worked"? What have you done and what was the result of your action?
fin swimmer
If your output file is empty and you didn't get any error message means that all id's in your fasta matches to the id's in your Tran_Cod.txt. Could this be?
What happens if you remove the -v?
Could please post the output of head Tran_Cod.txt?
You can easily achieve this with seqtk.
Quoting from the manual :
Extract sequences with names in file name.lst, one sequence name per line:
seqtk subseq in.fq/fa name.lst > out.fq/fa
Log in to answer this question.
-
Subseq a FASTA file
written by Explorer •
-
Fast way to extract specific sequences from large fasta
written by mnsp088 •
-
Samtools extraction output is empty
written by spidcock01 •
-
Problem with FASTA filtering
written by Janey •
-
Remove sequence from fasta file by samtools
written by Janey •
-
Extract sequence from multifasta file using samtools
written by Lorraine Lebönk •
-
extract sequences from multi fasta using partial ID
written by dago
-
adit sequences ID
written by Kurban
-
Remove Duplicates In Fasta (Protein Seq.)
written by IsmailM
-
Samtool (Faidx) - Signal 11 Termination Error
written by IsmailM
are these fasta files flattened i.e is the sequence in a single line after each ID? Then you can use:
grep -A 1 -w <ID> input.fastaeg: output:
input:
hi cpad0112
my fasta file is like this:
ATCAAAAATAGTTTCAGTTTGTGAAAAAATTCATTCTCTCAATCTCTTGTTTTACTTTTG AATTATAAACTCGAGGCAAAGAAAAATGTTCATTCAAGAAGATTGATACCCAGTGTGCTC ATAATGAAGAAGAAATTCGAAAGTAGAACATTCGGTATTTGGTCAAAGAAGAAATGTCGT CTTCTCAAGTTACAGCTGTTCCAACTTCACCACCAAAAACTATTCGTCATACTGCTGATT TCCATCCCACAATATGGGGAGATCAATTCCTCAAAGATACTTCTGAACTCAAGGTAATTA CACGTACACACTCTATATGAGATTAAATTTCTAAATGCACCCACCCTATGCATGCACATC ACAATAAACG
ATCAAAAATAGTTTCAGTTTGTGAAAAAATTCATTCTCTCAATCTCTTGTTTTACTTTTG AATTATAAACTCGAGGCAAAGAAAAATGTTCATTCAAGAAGATTGATACCCAGTGTGCTC ATAATGAAGAAGAAATTCGAAAGTAGAACATTCGGTATTTGGTCAAAGAAGAAATGTCGT CTTCTCAAGTTACAGCTGTTCCAACTTCACCACCAAAAACTATTCGTCATACTGCTGATT TCCATCCCACAATATGGGGAGATCAATTCCTCAAAGATACTTCTGAACTCAAGGTAATTA CACGTACACACTCTATATGAGATTAAATTTCTAAATGCACCCACCCTATGCATGCACATC ACAATAAACG
What is the solution to my problem??
do you want to remove the duplicate sequences? Botht the sequences look duplicate to me: if you want to remove dups,
$ seqkit rmdup --quiet -i -n test.fa. If it is an example file, then try$ grep -A 1 -w '> c50249_g1_i3' input.fa. This assumes that sequence is in a single row next to id.I have one IDs list that want to remove their related sequences. and my fasta file is like that with several lines. now, do you have command for me??