This is a test version of Biostars. For the public version, visit https://www.biostars.org.
HTSeq-count: Type error

Hi,

I have the following error when trying to run HTSeq-count :

"Error occured when processing SAM input (record #33999407 in file ConAc_A2-11D.sorted.bam):
  Expected str, got NoneType
  [Exception type: TypeError, raised in _HTSeq.pyx:59]"

Could someone please help me to fix this error.

This is the 33999407 record in my sam file:

HWI-ST766:189:C7R8BACXX:1:1101:19000:4363       141     *       0       0       *       *       0       0       CTATAGATTACAGTACTGTGAAGGAATGTTGAAAAACTATGTCAACCTTAAAAAAGAAGATTTTTTTTATCGTACCTTGTGTATCAGGGTTCTGCAAAT     <0<0B00B<BBBBBBB<B0<BBB070B7B<0<000'B<B<<7B7<'BBBBB0BBBBBBBBBBB'<7<<<B'0<<'7<<B7B<BB<7<7<<<<<7070<B     NH:i:0  HI:i:0  AS:i:121        nM:i:10 uT:A:1  RG:Z:ConAc_A2-11D
rna-seq

Which aligner was used to get this sam file?

0 answers

No answers yet.

Log in to answer this question.