Hello everyone, I have a fasta files containing genomes of bacterias and I would like to extract only 16s rRNA gene, I have tried with R packages like "micropan" with the function barrnap using the following code barrnap(genome.file = "file_containing_genome.fasta",bacteria = T,cpu = 8) and the output is the next
Seqid Source Type Start End Score Strand Phase Attributes NC_009925 barrnap:0.7 rRNA 1405563 1405673 4.2e-09 - NA Name=5S_rRNA;product=5S ribosomal RNA NC_009925 barrnap:0.7 rRNA 1409150 1410649 0.0e+00 - NA Name=16S_rRNA;product=16S ribosomal RNA NC_009925 barrnap:0.7 rRNA 5636176 5637675 0.0e+00 + NA Name=16S_rRNA;product=16S ribosomal RNA NC_009925 barrnap:0.7 rRNA 5641152 5641262 4.2e-09 + NA Name=5S_rRNA;product=5S ribosomal RNA
Is there a way to extract the gene with the position provided from this function? or Is there another way to extract this gene?
•
written
by
ulises.rodriguez •
1 answer
I'll recommend you to do in sillico PCR using constant region primers of 16S gene. For instance :
- 8F : AGAGTTTGATCCTGGCTCAG
- 1492R : CGGTTACCTTGTTACGACTT
For this purpose, you can use cutadapt ( see my solution ) or this tools https://github.com/simonrharris/in_silico_pcr (not tested)
http://help.bioiplug.com/16s-rrna-and-16s-rrna-gene/
Log in to answer this question.
