This is a test version of Biostars. For the public version, visit https://www.biostars.org.
prinseq error: Use of uninitialized value $qual in scalar chomp

Running fastq-generated SRA files from NCBI through prinseq-lite. The program generates an error:

Use of uninitialized value $qual in scalar chomp at /apps/prinseq/0.20.4/bin/prinseq-lite.pl line 2583, <FILE> line 26875674.

It still continues on until it has finished, but clearly there is something wrong going on. Here's what comes up when I look around that line:

sed -n 26875668,26875680p ../../test_1_renamed.fastq 
CCCFFFFFHGHHHJJJJFHIJJJJJIGII@GIIIJJJJJJJJJJJIJJJJJJJJHHHHAEHFFFFFFEEEECCEDDDDCD>CDEDDDDADC
@SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
CTCCTTCCCAAAGTAGCACTTCCTTCCCTTCTCGCTACGATCAAGAGATTTAGCCATCCCTGACCGAGATCGTTGTGAACTCTGGCTTTTT
+SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
@@CFFDFFFHHGDDHIIJJJJGHGHDFHIJGIHHIIIIIEEGHIJ@HIIJHGJJJCEGHGEEHGAEHED?@BCBC?;@>CCC:AC5<BDC@
@SRR5040251.6718919/1 FCC4LTMACXX:1:1215:20521:14498 length=91
CGAAGGAAACATCATAAGAAGCATCACAAAG

One person told me that the @ character in the quality line is an invalid character. I've read elsewhere that it is a valid character, plus it occurs in lines before this and they don't thrown this error. However, I wonder if the @ character at the beginning of the quality line might be throwing the program off.

prinseq software error sequence

This seems to be a problem with prinseq. No error with bbduk.sh from BBMap suite.

$ bbduk.sh in=in.fq out=stdout.fq ref=adapters.fa ktrim=r
java -Djava.library.path=/../bbmap/jni/ -ea -Xmx42m -Xms42m -cp /../bbmap/current/ jgi.BBDukF in=in.fq out=stdout.fq ref=adapters.fa ktrim=r
Executing jgi.BBDukF [in=in.fq, out=stdout.fq, ref=adapters.fa, ktrim=r]
Version 37.99 [in=in.fq, out=stdout.fq, ref=adapters.fa, ktrim=r]

0.043 seconds.
Initial:
Memory: max=42m, free=29m, used=13m

Added 2970 kmers; time:         0.056 seconds.
Memory: max=42m, free=28m, used=14m

Input is being processed as unpaired
Started output streams: 0.008 seconds.
@SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
CTCCTTCCCAAAGTAGCACTTCCTTCCCTTCTCGCTACGATCAAGAGATTTAGCCATCCCTGACCGAGATCGTTGTGAACTCTGGCTTTTT
+
@@CFFDFFFHHGDDHIIJJJJGHGHDFHIJGIHHIIIIIEEGHIJ@HIIJHGJJJCEGHGEEHGAEHED?@BCBC?;@>CCC:AC5<BDC@
Processing time:                0.005 seconds.

Input:                          1 reads                 91 bases.
KTrimmed:                       0 reads (0.00%)         0 bases (0.00%)
Total Removed:                  0 reads (0.00%)         0 bases (0.00%)
Result:                         1 reads (100.00%)       91 bases (100.00%)

Time:                           0.072 seconds.
Reads Processed:           1    0.01k reads/sec
Bases Processed:          91    0.00m bases/sec

0 answers

No answers yet.

Log in to answer this question.