This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Samtools faidx non-zero exit status 217

I have been using something like samtools faidx hg19.fa chr1:115227843-115227863 to extract sequence for specified locations. However, for the particular command above I am getting: Command 'samtools faidx hg19.fa chr1:115227843-115227863' returned non-zero exit status 127. Am I doing something wrong here?

sequence
• 2,973 views • link
written by L. A. Liggett L. A. Liggett

Just wondering, does samtools itself work when you type samtools? As the manual says, "if a command is not found, the child process created to execute it returns a status of 127" GNU

• 1 views • link
written by FatihSarigol FatihSarigol

Yeah samtools does appear to be working fine. I'll try building a new reference and see if this helps.

• 1 views • link
written by L. A. Liggett L. A. Liggett

Maybe your index or fasta are corrupted? Which version of samtools? With samtools 1.3.1:

samtools faidx hg19.fa chr1:115227843-115227863

>chr1:115227843-115227863

TGCTTCCCTGCTTCCAATGGC

• 1 views • link
written by h.mon h.mon

0 answers

No answers yet.

Log in to answer this question.

More posts like this